Applications of human SAMD9L gene and protein product encoded by human SAMD9L gene

A gene and protein technology is applied to the application of the human SAMD9L gene and its encoded protein product in the diagnosis and treatment of liver cancer, which can solve the problem of no public report of the SAMD9L protein, and achieve the effect of accurate diagnosis and control of proliferation.

Inactive Publication Date: 2014-02-12
CHINESE NAT HUMAN GENOME CENT AT SHANGHAI
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Currently, there are no published reports involving the use of human SAMD9L protein in inhibiting tumors

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Applications of human SAMD9L gene and protein product encoded by human SAMD9L gene
  • Applications of human SAMD9L gene and protein product encoded by human SAMD9L gene
  • Applications of human SAMD9L gene and protein product encoded by human SAMD9L gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 110

[0043] Example 1 Exome capture sequencing of 10 liver cancer patients

[0044] 1. A total of 29 tissue samples from 10 patients with liver cancer in Guilin, Guangxi, my country (10 paracancerous tissues, 10 cancerous tissues, and 9 portal vein tumor thrombus tissues, of which DNA in one patient’s liver portal vein tumor thrombus tissue was severely degraded) were organized DNA extraction.

[0045] The tissue DNA extraction kit from QIAGEN, Germany was used, and the experimental steps were carried out according to the product instructions. The extracted DNA passed the quality inspection by ND-1000 spectrophotometer and 0.8% agarose gel electrophoresis before it was ready for use. One patient's portal vein tumor thrombus tissue DNA was degraded, and the DNA quality of the remaining 29 tissue samples met the requirements.

[0046] 2. Nimblegen exon capture, the genomic DNA is first randomly broken into fragments of about 500bp, and then adapters are connected to both ends of the...

Embodiment 2

[0053] The Sanger method sequencing of embodiment 2 PCR products

[0054] 1. PCR amplifies a specific DNA fragment in the coding region of the SAMD9L gene, and the primer sequence is as follows ("F" stands for forward primer, "R" stands for reverse primer):

[0055] P55-F: GATCTGCCGTTGCAGAAAAT (SEQ ID NO: 1),

[0056] P55-R: TGGTTTGCTGTGTTGGAGTT (SEQ ID NO: 2);

[0057] P929-F: GGCCTTCAATGGAAAATCCT (SEQ ID NO: 3),

[0058] P929-R: AGACCTCCTGCGTCGTCTAA (SEQ ID NO: 4);

[0059]Using high-fidelity hot-start DNA polymerase Hotstar Taq, the PCR reaction system is as follows: forward primer, reverse primer, 10×PCR buffer, MgCl 2 , dNTP, Hotstar Taq DNA polymerase (QIAGEN Company), DNA template (sample in Example 1), the volumes of each component are 0.5, 0.5, 5, 1, 0.5, 0.1, 1 μl, and finally add sterile deionized Water made the reaction volume 50 μl.

[0060] The reaction conditions for PCR were deformation at 95°C for 5 minutes, followed by denaturation at 95°C for 30 seconds...

Embodiment 3

[0063] Example 3 Sequencing analysis of SAMD9L gene coding sequence in 80 liver cancer patient tissues by Sanger method

[0064] 1. The tissue samples of 80 cases of liver cancer patients were obtained from the surgically excised cancer tissue and paracancerous tissue samples of liver cancer patients in hospitals in Guilin, Guangxi, Wuxi, Jiangsu, and Suzhou, Jiangsu. All tissue samples were frozen and stored at -80°C. The human tissue manipulations involved were approved by the Ethics Committee of the National Human Genome Southern Research Center.

[0065] 2. The tissue DNA extraction kit from QIAGEN, Germany was used, and the experimental steps were carried out according to the product instructions.

[0066] 3. The coding sequence of the SAMD9L gene is located on the fifth exon of the gene, and the coding nucleic acid sequence (CCDS34681.1) comes from the NCBI nucleic acid sequence database (http: / / www.ncbi.nlm.nih.gov / ), according to SAMD9L Primers were designed for the c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The present invention discloses applications of human SAMD9L gene and a protein product encoded by the human SAMD9L gene, wherein the SAMD9L gene sequence, especially the open reading frame sequence of the protein encoded by the human SAMD9L gene, generates missense mutation, nonsense mutation, frameshift mutation and other gene structure variations with different forms in tumors so as to be adopted as the specific marker gene for liver cancer diagnosis, such that liver cancer diagnosis is accurate and rapid. According to the present invention, the human SAMD9L protein can be applied on tumor patients so as to treat or alleviate related diseases caused by SAMD9L protein deletion, nonfunction or abnormality; and the human SAMD9L gene can be over-expressed in cancer cells through the transgenic technology, or the SAMD9L protein can be supplied through the in vitro supply manner to control cancer cell proliferation and metastasis so as to achieve the tumor treatment purpose.

Description

technical field [0001] The invention relates to the application of a gene and its encoded protein product, in particular to the application of a human SAMD9L gene and its encoded protein product in the diagnosis and treatment of liver cancer. Background technique [0002] Liver cancer causes 600,000 deaths every year, and is one of the malignant tumors that seriously threaten the health of our people. The pathogenesis of liver cancer involves many factors, including hepatitis B virus, hepatitis C virus, alcohol, and aflatoxin pollution. In my country's liver cancer patients, hepatitis B virus infection is the main factor. The activation of oncogenes and the inactivation of tumor suppressor genes are the molecular mechanisms of liver cancer. Although previous studies have found that the inactivation of tumor suppressor genes, such as TP53, and the activation of oncogenes, such as β-catenin and gp130, are all caused by somatic mutations in liver cancer, the genetic events in...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11C12N15/113A61K48/00A61K38/17A61P35/00A61P35/04
CPCC12Q1/6886A61K38/1761A61K48/005C12N15/1135C12N2310/14C12Q2600/156
Inventor 王群韩泽广邓庆
Owner CHINESE NAT HUMAN GENOME CENT AT SHANGHAI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap