Unlock instant, AI-driven research and patent intelligence for your innovation.

BIM (Bcl-2 Interacting Mediator of Cell Death) gene mutation detection method and kit

A kit and reagent technology, applied in the field of BIM gene mutation detection and kits, can solve the problems of dependent cell apoptosis, lack of polymorphism and race differences, lack of BH3 domain and other problems

Active Publication Date: 2014-10-01
HUZHOU SHUWEN BIOTECH
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Screening of 2597 healthy individuals found that this deletion polymorphism occurred in nearly one-eighth of East Asian individuals, but it was not found in Africans and Europeans, indicating that the BIM deletion polymorphism has racial differences

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • BIM (Bcl-2 Interacting Mediator of Cell Death) gene mutation detection method and kit
  • BIM (Bcl-2 Interacting Mediator of Cell Death) gene mutation detection method and kit
  • BIM (Bcl-2 Interacting Mediator of Cell Death) gene mutation detection method and kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Three pairs of primers were designed as follows:

[0034] Primer pairs to amplify the first wild-type sequence:

[0035] Generic upstream: BIM-FP: 5' TAAATACCATCCAGCTCTGTCTTC 3' (SEQ ID NO:7)

[0036] Wild downstream: BIM-wRP: 5' ACCTCCTGGCATTTGGCAAG 3' (SEQ ID NO:8)

[0037] Primer pairs for amplifying mutant sequences:

[0038] Generic upstream: BIM-FP: 5' TAAATACCATCCAGCTCTGTCTTC 3' (SEQ ID NO:9)

[0039] Mutation downstream: BIM-dRP: 5'-GGTAAGTATGTGGAGAAACTGG -3' (SEQ ID NO:10)

[0040] Primer pairs for amplifying the second wild-type sequence:

[0041] BIM-mFP: 5' TGGGGTAGAGATCAGTGTGTCTTG 3' (SEQ ID NO: 11)

[0042] BIM-mRP2: 5' TCCTTGAACTTGTCTTCAGAAAAATC 3' (SEQ ID NO: 12)

[0043] Optimizing the PCR reaction system

[0044] composition Volume(μl) Final con 5XGotaq buffer 5 1X dNTP (10mM) 0.5 200mM EvaGreen (20X) 1 BIM-FP (10μM) 0.5 200nM BIM-wRP (10μM) 0.25 100nM BIM-dRP (10μM) 0.25 100nM B...

Embodiment 2

[0049] Three pairs of primers were designed as follows:

[0050] Primer pairs for amplifying wild-type sequences:

[0051] Upstream: BIM-wFP-3: 5' AACTGGGAATAGTGGGTGAG 3' (SEQ ID NO: 13)

[0052] Downstream: BIM-wRP-3: 5'TTTCATCTCAAGTAACAGTGC 3' (SEQ ID NO: 14)

[0053] Primer pairs for amplifying mutant sequences:

[0054] Generic upstream: BIM-dmFP: 5' CAGTGAGGTAAATCACTGTTC 3' (SEQ ID NO: 15)

[0055] Mutation downstream: BIM-dmRP-2: 5'- TGCCCTGTTGGGAATG -3' (SEQ ID NO:16)

[0056] Primer pairs to amplify the second mutant sequence:

[0057] Generic upstream: BIM-dmFP: 5' CAGTGAGGTAAATCACTGTTC 3' (SEQ ID NO: 17)

[0058] Mutation downstream: BIM-dmRP-3: 5' GGTAAGTATGTGGAGAAACTGG 3' (SEQ ID NO: 18)

[0059] Optimizing the PCR reaction system

[0060] composition Volume(μl) Final con 5XGotaq buffer 5 1X dNTP (10mM) 0.5 200mM EvaGreen (20X) 1 BIM-FP (10μM) 0.5 200nM BIM-wRP (10μM) 0.25 100nM BIM-dRP (10μM) 0.25 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a diagnosis method and a kit, and in particular to a gene mutation detection method and a kit for personalized medicine. The kit for detecting BIM (Bcl-2 Interacting Mediator of Cell Death) gene deletion mutation comprises a first amplification primer pair which can amplify a first amplification sequence of SEQIDNO.5 to form a first amplicon which is smaller than 1000bp, wherein the first amplification primer pair cannot amplify any sequence of SEQIDNO.1, or can amplify a section of sequence in SEQIDNO.1 to generate an amplicon which is 2903bp longer than the first amplicon, and cannot amplify any sequence in SEQIDNO.5 but can amplify a section of a second amplification sequence in SEQIDNO.1 so as to generate a second amplification primer pair of second amplicon. The kit provided by the invention can be applied to personalized treatment on tumor.

Description

technical field [0001] The invention, the diagnostic method and the kit, especially relate to the gene mutation molecular diagnosis method and the kit for individualized medicine. Background technique [0002] Tyrosine kinase inhibitors (TKIs) kill cancer cells by inducing programmed cell apoptosis and are given to lung cancer patients with chronic myeloid leukemia (CML) and epidermal growth factor mutations (EGFR NSCLC) brings enormous therapeutic benefits, but the extent and duration of effective treatment varies from person to person, thus suggesting that there are other genetic modifications that affect the body's response to TKIs. [0003] Scientists Ng and Hillmer from Duke-Singapore University School of Medicine performed genome sequencing analysis on CML patients and found that the gene encoding BCL2-like 11 (BIM) protein has an intron deletion polymorphism. BIM is a pre-apoptotic member of the BCL2 protein family, which has a powerful killing function on patholo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
CPCC12Q1/6851C12Q1/6858C12Q2531/113C12Q2527/107C12Q2563/107
Inventor 张以哲
Owner HUZHOU SHUWEN BIOTECH