Unlock instant, AI-driven research and patent intelligence for your innovation.
BIM (Bcl-2 Interacting Mediator of Cell Death) gene mutation detection method and kit
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A kit and reagent technology, applied in the field of BIM gene mutation detection and kits, can solve the problems of dependent cell apoptosis, lack of polymorphism and race differences, lack of BH3 domain and other problems
Active Publication Date: 2014-10-01
HUZHOU SHUWEN BIOTECH
View PDF2 Cites 0 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
Screening of 2597 healthy individuals found that this deletion polymorphism occurred in nearly one-eighth of East Asian individuals, but it was not found in Africans and Europeans, indicating that the BIM deletion polymorphism has racial differences
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0033] Three pairs of primers were designed as follows:
[0034] Primer pairs to amplify the first wild-type sequence:
[0035] Generic upstream: BIM-FP: 5' TAAATACCATCCAGCTCTGTCTTC 3' (SEQ ID NO:7)
[0036] Wild downstream: BIM-wRP: 5' ACCTCCTGGCATTTGGCAAG 3' (SEQ ID NO:8)
[0037] Primer pairs for amplifying mutant sequences:
[0038] Generic upstream: BIM-FP: 5' TAAATACCATCCAGCTCTGTCTTC 3' (SEQ ID NO:9)
[0039] Mutation downstream: BIM-dRP: 5'-GGTAAGTATGTGGAGAAACTGG -3' (SEQ ID NO:10)
[0040] Primer pairs for amplifying the second wild-type sequence:
[0041] BIM-mFP: 5' TGGGGTAGAGATCAGTGTGTCTTG 3' (SEQ ID NO: 11)
[0042] BIM-mRP2: 5' TCCTTGAACTTGTCTTCAGAAAAATC 3' (SEQ ID NO: 12)
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
PUM
Login to View More
Abstract
The invention relates to a diagnosis method and a kit, and in particular to a genemutation detection method and a kit for personalized medicine. The kit for detecting BIM (Bcl-2 Interacting Mediator of Cell Death) genedeletion mutation comprises a first amplification primer pair which can amplify a first amplification sequence of SEQIDNO.5 to form a first amplicon which is smaller than 1000bp, wherein the first amplification primer pair cannot amplify any sequence of SEQIDNO.1, or can amplify a section of sequence in SEQIDNO.1 to generate an amplicon which is 2903bp longer than the first amplicon, and cannot amplify any sequence in SEQIDNO.5 but can amplify a section of a second amplification sequence in SEQIDNO.1 so as to generate a second amplification primer pair of second amplicon. The kit provided by the invention can be applied to personalized treatment on tumor.
Description
technical field [0001] The invention, the diagnostic method and the kit, especially relate to the genemutation molecular diagnosis method and the kit for individualized medicine. Background technique [0002] Tyrosinekinase inhibitors (TKIs) kill cancer cells by inducing programmed cellapoptosis and are given to lungcancer patients with chronic myeloid leukemia (CML) and epidermal growth factor mutations (EGFR NSCLC) brings enormous therapeutic benefits, but the extent and duration of effective treatment varies from person to person, thus suggesting that there are other genetic modifications that affect the body's response to TKIs. [0003] Scientists Ng and Hillmer from Duke-Singapore University School of Medicine performed genome sequencing analysis on CML patients and found that the gene encoding BCL2-like 11 (BIM) protein has an intron deletion polymorphism. BIM is a pre-apoptotic member of the BCL2 protein family, which has a powerful killing function on patholo...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.