Method and kit for diagnosing methylation of human shox2 gene and human rassf1a gene
A kit and methylation technology, applied in the field of gene diagnosis, can solve the problems of difficult early diagnosis, difficult early detection and early qualitative diagnosis of lung cancer, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0049] Embodiment 1, the selection of detection target gene
[0050] Methylated DNA has obvious advantages as a detection target. Compared with protein markers, DNA can be amplified and easily detected; compared with mutation markers, methylated DNA is located in a specific part of the gene , generally in the promoter region, making detection easier and more convenient. In order to complete the present invention, the inventor consulted a large number of documents, and among the genes related to lung cancer reported, select representative p16, H-cadherin (CDH13), SHOX2, HOXA9, RARβ, RASSF1A as candidate detection genes, research The distribution of methylation sites of each gene, and the primers and probes designed for detection were used for detection. The detection primers and probes for each gene are as follows:
[0051] The detection primers and probes for p16 are:
[0052]pl6 Primer F: ACGTCGTGAGCGAGTGTTC (SEQ ID NO: 27);
[0053] pl6 Primer R: TACCAACGCTAACTCTAACGAA (...
Embodiment 2
[0099] Embodiment 2, primer and probe design
[0100] In order to optimize the detection reagents suitable for simultaneous detection of human SHOX2 gene and human RASSF1A gene methylated DNA, the inventors conducted in-depth research on each gene sequence, and after repeated research and comparison, selected the amplification region sequence of each gene, As shown in table 2.
[0101] Table 2
[0102]
[0103]
[0104] According to the regions determined in Table 2, the inventors further optimally designed specific primers and detection probes. The designed primers and detection probes are shown in Table 3. All primers and probes were synthesized by Sangon Bioengineering (Shanghai) Co., Ltd.
[0105] table 3
[0106]
[0107]
Embodiment 3
[0108] Embodiment 3, different primer probe combination experiments
[0109] DNA extraction, sulfite modification, detection system preparation, and PCR amplification procedures were the same as in Example 1, and the amplification objects were modified sample DNA and control DNA (DNA fragments of SHOX2 and RASS1FA). After the experiment runs, the analysis steps are as follows:
[0110] (1) Determine whether the experiment is credible:
[0111] (a) CY5 has a signal, and the Ct value of the CY5 signal is ≥ 12, it is reliable;
[0112] If the Ct value is less than 12, it indicates that the added DNA is too much, and the DNA should be diluted before doing it;
[0113] (b) If there is no CY5 signal, it indicates that the added DNA contains PCR inhibitors or the DNA treatment fails, and the DNA needs to be re-extracted and treated with sulfite;
[0114] Among them, the positive quality control product reaction tubes should have signals of FAM, VIC and CY5, and the negative qualit...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More