Method for identifying tobacco raw materials by applying FMYYSSR-4 marker
A tobacco and labeling technology, applied in the field of molecular biology research, can solve the problems of adding costs and steps
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] 1. Primer design for FMYYSSR-4 marker. The sequences of the upstream and downstream primers are CGTGCTCAAGGACATTCTCA and CTGCAGCTCCAATCCAGAAT, respectively.
[0027]2. DNA extraction of tobacco samples and samples to be tested: (1) Take different samples, grind their tissues into fine powders, and put them into 2 mL centrifuge tubes. (2) Add 600 μL of CTAB extraction buffer, mix evenly (CTAB is preheated in a 65°C water bath), shake gently every 3 min, and centrifuge at 12,000 r / min for 10 min after 20 min. (3) Carefully absorb the supernatant, add an equal volume of phenol:chloroform (each 400 μL) solution, mix well, and centrifuge at 12000 r / min at 4 °C for 10 min; (4) Carefully absorb the supernatant, add an equal volume chloroform, mix well, centrifuge at 12000 r / min at 4 °C for 10 min, and repeat twice until the protein layer does not appear. (5) Take the supernatant, precipitate at -20 °C for 1 h, centrifuge at 12000 r / min at 4 °C for 10 min; (6) discard the sup...
Embodiment 2
[0031] 1. Primer design for FMYYSSR-4 marker. The sequences of the upstream and downstream primers are CGTGCTCAAGGACATTCTCA and CTGCAGCTCCAATCCAGAAT, respectively.
[0032] 2. DNA extraction of tobacco samples and samples to be tested: (1) Take different samples, grind their tissues into fine powders, and put them into 2 mL centrifuge tubes. (2) Add 800 μL of CTAB extraction buffer, mix well (CTAB is preheated in a 65°C water bath), shake gently every 3-5 min, and centrifuge at 12,000 r / min for 15 min after 20 min. (3) Carefully aspirate the supernatant, add an equal volume of phenol:chloroform (each 400 μL) solution, mix well, and centrifuge at 12000 r / min at 4 °C for 15 min; (4) Carefully aspirate the supernatant, add an equal volume chloroform, mixed, 4 ℃, 12000 r / min, centrifuged for 15 min, repeated 3 times until the protein layer did not appear. (5) Take the supernatant, precipitate at -20 °C for 1-2 h, centrifuge at 12000 r / min at 4 °C for 15 min; (6) discard the supe...
Embodiment 3
[0036] 1. Primer design for FMYYSSR-4 marker. The sequences of the upstream and downstream primers are CGTGCTCAAGGACATTCTCA and CTGCAGCTCCAATCCAGAAT, respectively.
[0037] 2. DNA extraction of tobacco samples and samples to be tested: (1) Take different samples, grind their tissues into fine powders, and put them into 2 mL centrifuge tubes. (2) Add 700 μL of CTAB extraction buffer, mix well (CTAB is preheated in a 65°C water bath), shake gently every 4 min, and centrifuge at 12,000 r / min for 12 min after 20 min. (3) Carefully aspirate the supernatant, add an equal volume of phenol:chloroform (400 μL each) solution, mix well, centrifuge at 12000 r / min at 4 °C for 12 min; (4) carefully aspirate the supernatant, add an equal volume chloroform, mixed, 4 ℃, 12000 r / min, centrifuged for 12 min, repeated 3 times until the protein layer did not appear. (5) Take the supernatant, precipitate at -20 °C for 1-2 h, centrifuge at 12000 r / min at 4 °C for 12 min; (6) discard the supernatan...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More