dsrna inhibiting gene expression of aphid chloride ion channel and its application

A chloride channel and gene expression technology is applied in the field of dsRNA for inhibiting the expression of chloride channel genes of aphids, and can solve the problems of ineffective breeding of insect resistance, unclear resistance mechanism, and harm to humans and animals.

Inactive Publication Date: 2018-07-27
NANYANG NORMAL UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the control of aphids is mainly based on spraying pesticides, but a large amount of pesticides are not only harmful to humans and animals, but also cause serious environmental pollution.
Breeding insect-resistant crop varieties is the most effective way to prevent aphid damage, but due to the lack of effective aphid-resistant genes in the existing germplasm resources of crops, and the resistance mechanism is not clear, conventional insect-resistant breeding is difficult to work

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • dsrna inhibiting gene expression of aphid chloride ion channel and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1 Aphids SaCIC4 Gene dsRNA acquisition

[0037] (1) Extraction of total RNA and synthesis of cDNA

[0038] About 20 tube aphids were taken respectively, and total RNA was extracted according to the instructions of the Trizol kit of Beijing Quanshijin Company, purified with RNA Cleaning Kit, and the first strand of cDNA was synthesized by reverse transcription. The operation steps refer to the instructions of the kit.

[0039] (2) Primer design and gene cloning

[0040] Primers P1-F and P1-R were designed using Primer Primer5.0 software and synthesized by Beijing Huada Gene Company. GFP gene ( GFP ) fragment was amplified from the 16318hGFP plasmid preserved in the laboratory of the School of Life Science and Technology, Nanyang Normal University, and primers P2-F and P2-R were designed using Primer Primer5.0 software.

[0041] P1-F: 5'- TAATACGACTCACTATAGGG GAAAATGAAAAAATCGAAAG-3' (the underlined sequence is the 1st to 20th positions of SEQ ID No: 2);

...

Embodiment 2

[0059] Example 2 SaCIC4 Application of dsRNA in inhibiting the growth of aphids

[0060] (1) Preparation of artificial feed for aphids and preparation of feeders

[0061] References for preparation of artificial feed and feeder (Li Caixia, Gao Lifeng, Gao Lingling, Li Runzhi. Research on feeding aphids in pure artificial nutrient solution. Journal of Shanxi Agricultural University, 1997, 17(3): 225-228.) , filter artificial feed with a 0.2 μm bacterial filter, aliquot into 2.0 mL sterilized centrifuge tubes and store in a -20°C refrigerator to avoid repeated freezing and thawing.

[0062] (2) dsRNA ( SaCIC4 dsRNA) in inhibiting the growth of aphids

[0063] The feeding method of aphids is described in the following literature: Jiao Min, Liu Shusheng. The technology of feeding aphids with artificial diet. Acta Entomological Journal of East China, 2004, 13(2): 102-109.

[0064] Aphid aphid SaCIC4 dsRNA feeding group: put 20 3rd-instar nymphs of A. sativa in each aphid fe...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a dsRNA for inhibiting gene expression of aphid chloride ion channel and application thereof. The dsRNA for inhibiting the expression of the aphid chloride ion channel gene is specifically a double-stranded RNA composed of the nucleotides of the sequence shown in SEQ ID No: 1 and the nucleotides of the reverse complementary sequence thereof. The application is to introduce the dsRNA into aphids, so as to prevent and control aphids, reduce the survival rate of aphids or inhibit the expression of chloride ion channel genes of aphids. The invention adopts the method of feeding dsRNA in vitro, utilizes the RNAi technology to silence the chloride ion channel gene of the aphid, and causes the lethal effect of the aphid. The real-time fluorescent quantitative PCR study of chloride ion channel gene in aphids after feeding showed that the expression of chloride ion channel gene was significantly inhibited. It shows that the sequence of aphid chloride channel gene can be applied to the research of improving wheat aphid resistance through plant-mediated RNAi technology.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and in particular relates to a dsRNA for inhibiting the expression of aphid chloride ion channel gene and application thereof. Background technique [0002] Aphids are one of the main pests that endanger crop production. In recent years, factors such as global warming and changes in farming systems have significantly enhanced the reproductive capacity and adaptability of aphids. The damage is becoming more and more serious, causing hundreds of millions of economic losses every year. Taking wheat aphids as an example, wheat aphids gather as nymphs on wheat leaves, stems, ears, etc., and suck juice, causing irregular shrinkage, curling, and chlorosis of leaves, and in severe cases, plant death. The honeydew secreted by the wheat aphid adheres to the surface of the plant, reduces the photosynthesis of the plant, and easily induces soot disease. At the same time, wheat aphid is also an import...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113C12N15/11A01N57/16A01P7/04
Inventor 喻修道刘宗才段鹏飞陈志勤雷霆
Owner NANYANG NORMAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap