Unlock instant, AI-driven research and patent intelligence for your innovation.

A gene with triacylglycerol synthesis function and its application

A triacylglycerol and diacylglycerol acyl technology, applied in application, genetic engineering, plant genetic improvement, etc., can solve the problems of temporal and spatial differences in expression patterns

Active Publication Date: 2019-07-12
QINGDAO INST OF BIOENERGY & BIOPROCESS TECH CHINESE ACADEMY OF SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In higher plants, although the functional difference between type I and type II DGAT is still under debate, current reports tend to believe that the expression patterns of the two are different in both space and time

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A gene with triacylglycerol synthesis function and its application
  • A gene with triacylglycerol synthesis function and its application
  • A gene with triacylglycerol synthesis function and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1: Cloning and analysis of NoDGAT full-length coding region

[0035] The DGAT gene was cloned from the cDNA of Nannochloropsis oceanica (IMET1) by PCR technology, and the primers used were designed according to the data analysis basis of the previous laboratory, and the required enzyme cutting sites were introduced at both ends of the primers. Handed over to Shanghai Sangong Synthetic:

[0036] NoDGAT-for: 5'ATGACGCCGCAAGCCGAC 3';

[0037] NoDGAT-rev: 5' CTCAATGGACAACGGGCGCGTCT 3'.

[0038] The PCR instrument used was MasterCycler from Eppendorf Company, the reaction system was 50 μL, including 4 μL of dNTP (2.5 mM each, TAKARA), 2 μL of forward and reverse primers (10 μM), 5 μL of 10×buffer (Mg2 + plus, TAKARA), 0.4 μL rTaq enzyme (5U / μL, TAKARA), 1 μL DNA template (50ng / μL, equal volumes of the corresponding plasmid and wild-type DNA were added to the positive and negative controls, respectively), and 35.6 μL of ultrapure water. The reaction system is as fo...

Embodiment 2

[0055] Example 2: Protein structure and homology analysis encoded by NoDGAT

[0056] Using NCBI ( http: / / blast.ncbi.nlm.nih.gov / Blast.cgi ) analyzed the protein encoded by NoDGAT, and the results showed that the protein encoded by the gene had a LPLAT_MGAT-like domain.

[0057] Use MEGA4.1 program to carry out homologous comparison analysis on the amino acid sequence of NoDGAT, see figure 1 . Analysis results show that it has high homology with homologous genes in higher plants, for example, the homology with Arabidopsis AtDGAT-2 is 34%. The homology with animals is relatively low, for example, the homology with human HsDGAT-2 is only 27%. In the figure, the black shaded part represents the conserved amino acid. The squares represent a His and a Phe that are conserved and play a key role in all DGATs. The compared species are human Hs (NCBI accession number AY358532), mouse Mm (NM026384), tung tree Vf (ABC94473), castor Rc(XP002528531), Euonymus Ea(ADF57328), Arabidopsis...

Embodiment 3

[0058] Embodiment 3: the application of NoDGAT in yeast

[0059] (1) Construction of yeast expression vector

[0060] see figure 2 . The specific method for constructing the vector is as follows: the full-length ORF fragment of NoDGAT is amplified by using the cDNA of Nannochloropsis IMET1 as a template by PCR method. In order to construct cloning, with the help of primer introduction method, a KpnI restriction site and a protective base are added to the 5' end of the target sequence, and an EcoRI restriction site is added to its 3' end. The primer sequences are as follows:

[0061] NoDGAT-for-KpnI:

[0062]

[0063] NoDGAT-rev-EcoRI:

[0064]

[0065] At the same time, the yeast DGAT gene DGA1 was used as a positive control: the full-length ORF fragment of DGA1 was amplified by PCR method using the cDNA of yeast SCY62 as a template. In order to construct cloning, with the help of primer introduction method, a BamHI restriction site and a protective base are added ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention belongs to the technical field of biology, and relates to a gene having a triacylglycerol (TAG) synthesis function, and applications thereof, wherein the gene is the following nucleotide sequence: 1) the gene is base sequence represented by SEQ ID NO1; or, 2) the gene is the DNA sequence sharing more than or equal to 95% of homology with the nucleic acid sequence limited by the sequence 1 in the sequence list and encoding the same biological function protein. According to the present invention, the gene having the TAG synthesis function is the diacylglycerol acyltransferase (DGAT) gene isolated from Nannochloropsis, and has important application values in the improvement of the TAG content in the organism.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a gene with triacylglycerol (TAG) synthesis function and application thereof. Background technique [0002] Under the guidance of the concepts of energy saving, emission reduction, and low carbon, the development of renewable energy has become a popular research direction. At present, most renewable energy sources provide energy in the form of power generation, but since most transportation vehicles still use liquid fuels as energy sources, electric energy cannot directly solve the power problem of current transportation vehicles. [0003] Biofuel is currently the only renewable energy that can be used as liquid fuel, so it occupies an important position in the development of renewable energy. Bioethanol and biodiesel are the two most promising biofuels to replace petroleum because of their potential for large-scale production. Of the two, biodiesel is more suitable for the current i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/54C12N9/10C12N15/10C12N15/81C12N1/19C12P7/64C12R1/865
Inventor 徐健辛一路延笃
Owner QINGDAO INST OF BIOENERGY & BIOPROCESS TECH CHINESE ACADEMY OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More