A gene with triacylglycerol synthesis function and its application
A triacylglycerol and diacylglycerol acyl technology, applied in application, genetic engineering, plant genetic improvement, etc., can solve the problems of temporal and spatial differences in expression patterns
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Example 1: Cloning and analysis of NoDGAT full-length coding region
[0035] The DGAT gene was cloned from the cDNA of Nannochloropsis oceanica (IMET1) by PCR technology, and the primers used were designed according to the data analysis basis of the previous laboratory, and the required enzyme cutting sites were introduced at both ends of the primers. Handed over to Shanghai Sangong Synthetic:
[0036] NoDGAT-for: 5'ATGACGCCGCAAGCCGAC 3';
[0037] NoDGAT-rev: 5' CTCAATGGACAACGGGCGCGTCT 3'.
[0038] The PCR instrument used was MasterCycler from Eppendorf Company, the reaction system was 50 μL, including 4 μL of dNTP (2.5 mM each, TAKARA), 2 μL of forward and reverse primers (10 μM), 5 μL of 10×buffer (Mg2 + plus, TAKARA), 0.4 μL rTaq enzyme (5U / μL, TAKARA), 1 μL DNA template (50ng / μL, equal volumes of the corresponding plasmid and wild-type DNA were added to the positive and negative controls, respectively), and 35.6 μL of ultrapure water. The reaction system is as fo...
Embodiment 2
[0055] Example 2: Protein structure and homology analysis encoded by NoDGAT
[0056] Using NCBI ( http: / / blast.ncbi.nlm.nih.gov / Blast.cgi ) analyzed the protein encoded by NoDGAT, and the results showed that the protein encoded by the gene had a LPLAT_MGAT-like domain.
[0057] Use MEGA4.1 program to carry out homologous comparison analysis on the amino acid sequence of NoDGAT, see figure 1 . Analysis results show that it has high homology with homologous genes in higher plants, for example, the homology with Arabidopsis AtDGAT-2 is 34%. The homology with animals is relatively low, for example, the homology with human HsDGAT-2 is only 27%. In the figure, the black shaded part represents the conserved amino acid. The squares represent a His and a Phe that are conserved and play a key role in all DGATs. The compared species are human Hs (NCBI accession number AY358532), mouse Mm (NM026384), tung tree Vf (ABC94473), castor Rc(XP002528531), Euonymus Ea(ADF57328), Arabidopsis...
Embodiment 3
[0058] Embodiment 3: the application of NoDGAT in yeast
[0059] (1) Construction of yeast expression vector
[0060] see figure 2 . The specific method for constructing the vector is as follows: the full-length ORF fragment of NoDGAT is amplified by using the cDNA of Nannochloropsis IMET1 as a template by PCR method. In order to construct cloning, with the help of primer introduction method, a KpnI restriction site and a protective base are added to the 5' end of the target sequence, and an EcoRI restriction site is added to its 3' end. The primer sequences are as follows:
[0061] NoDGAT-for-KpnI:
[0062]
[0063] NoDGAT-rev-EcoRI:
[0064]
[0065] At the same time, the yeast DGAT gene DGA1 was used as a positive control: the full-length ORF fragment of DGA1 was amplified by PCR method using the cDNA of yeast SCY62 as a template. In order to construct cloning, with the help of primer introduction method, a BamHI restriction site and a protective base are added ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap