Gene modification method of eukaryotes and corresponding genetically engineered cell, and application thereof

A genetic engineering and genetic modification technology, applied in the field of enhancing the protein synthesis ability of eukaryotic cell-free protein reaction system, to achieve the effect of improving protein synthesis ability

Inactive Publication Date: 2020-05-08
KANGMA SHANGHAI BIOTECH LTD
View PDF4 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is no mature yeast cell extract system on the market at present, and the Kluyveromyces extract system we are committed to developing can fill this gap

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene modification method of eukaryotes and corresponding genetically engineered cell, and application thereof
  • Gene modification method of eukaryotes and corresponding genetically engineered cell, and application thereof
  • Gene modification method of eukaryotes and corresponding genetically engineered cell, and application thereof

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0064] In the present invention, the preparation method of the cell extract is not limited, and a preferred preparation method includes the following steps:

[0065] (i) providing cells;

[0066] (ii) washing the cells to obtain washed cells;

[0067] (iii) performing cell disruption treatment on the washed cells to obtain a crude cell extract;

[0068] (iv) performing solid-liquid separation on the crude cell extract to obtain the liquid part, which is the cell extract.

[0069] In the present invention, the solid-liquid separation method is not particularly limited, and a preferred method is centrifugation.

[0070] In the present invention, the centrifugation conditions are not particularly limited, and a preferred centrifugation condition is 5000-100000×g, preferably 8000-30000×g.

[0071] In the present invention, the centrifugation time is not particularly limited, and a preferred centrifugation time is 0.5min-2h, preferably 20min-50min.

[0072] In the present inven...

Embodiment 1

[0098] Example 1 Targeted insertion of T7 RNA polymerase at the C-terminus of eIF2Bδ gene by CRISPR / Cas9

[0099] 1.1 Kl eIF2Bδ CRISPR gRNA sequence determination

[0100] According to Kl To design the C-terminal insertion of eIF2Bδ gene (SEQ ID NO. 1) into T7 RNA polymerase, select the PAM sequence (NGG), and determine the corresponding gRNA sequence. The principle of gRNA selection in this example is: moderate GC content (40%-60%), and avoid the existence of poly T structure. In this example, Kl The eIF2Bδ gRNA sequence is CGACGAAGGTAAGAATGTCA.

[0101] Plasmid construction and transformation methods are as follows: use primer pCas9- Kl eIF2Bδ-gRNA-PF: CGACGAAGGTAAGAATGTCAGTTTTTAGAGCTAGAAATAGC and pCas9- Kl eIF2Bδ-gRNA-PR: TGACATTCTTACCTTCGTCGAAAGTCCCATTCGCCACCCG, using the pCAS plasmid as a template for PCR amplification. Take 17 µL of the amplification product, add 1 µL of Dpn I, 2 µL of 10 × digestion buffer, mix well for 37 o C water bath for 3 h. Take 10 µL of ...

Embodiment 2

[0114] Example 2 Targeted insertion of T7 RNA polymerase at the C-terminus of the eIF2Bε gene by CRISPR / Cas9

[0115] 2.1 Kl eIF2Bε CRISPR gRNA sequence determination

[0116] According to Kl To design the C-terminal insertion of eIF2Bε gene (SEQ ID NO. 3) into T7 transcriptase, select the PAM sequence (NGG), and determine the corresponding gRNA sequence. The principle of gRNA selection in this example is: moderate GC content (40%-60%), and avoid the existence of poly T structure. In this example, Kl The eIF2Bε gRNA sequence is GTATGATTTGGATATCTTAG.

[0117] Plasmid construction and transformation methods are as follows: use primer pCas9- Kl eIF2Bε-gRNA-PF: GTATGATTTGGATATCTTAGGTTTTAGAGCTAGAAATAGC and pCas9- Kl eIF2Bε-gRNA-PR: CTAAGATATCCAAATCATACAAAGTCCCATTCGCCACCCG, pCAS plasmid was used as template for PCR amplification. Take 17 µL of the amplification product, add 1 µL of Dpn I, 2 µL of 10 × digestion buffer, mix well for 37 o C water bath for 3 h. Take 10 µL of D...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a gene modification method of n eukaryotes. In the genome of a eukaryote, an eIF2B delta gene is fused with a T7 RNA polymerase gene and / or an eIF2B epsilon gene is fused with the T7 RNA polymerase gene through a gene editing technology. Tests prove that the protein expression capacity of a cell-free system can be remarkably improved by respectively fusing the T7 RNA polymerase with two subunits, namely eIF2B delta and eIF2B epsilon of an eIF2B complex. Meanwhile, the invention provides a genetically engineered cell modified by using the gene modification method, and aneukaryotic acellular protein synthesis system containing a cell extract prepared from the genetically engineered cell.

Description

technical field [0001] The invention relates to the field of biological technology, in particular to the fusion of eIF2Bδ and eIF2Bε with T7 RNA polymerase genes, which can enhance the protein synthesis ability of eukaryotic cell-free protein reaction system. Background technique [0002] The cell-free protein reaction system refers to an in vitro system that uses exogenous mRNA or DNA as a template to synthesize proteins in an enzyme system using cell extracts. Compared with the traditional in vivo recombinant expression system, the cell-free protein reaction system has many advantages, such as the ability to express cytotoxic proteins or special proteins containing unnatural amino acids, and it can be used for high-throughput drug screening and Proteomics research. Currently commonly used cell-free protein synthesis systems include prokaryotic Escherichia coli system, eukaryotic wheat germ extract and rabbit reticulocyte lysate system. Yeast cells are eukaryotic cells, a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/90C12N15/81C12N15/62C12P21/02C12R1/645
CPCC07K14/39C07K2319/00C12N9/1247C12N15/62C12N15/815C12N15/90C12N15/902C12N2810/10C12P21/02C12Y207/07006
Inventor郭敏许乃庆姜灵轩娄旭邓蜜妮杨旭占魁李海洋于雪
OwnerKANGMA SHANGHAI BIOTECH LTD