Multi-tag antigen, and preparation method and application thereof
A multi-label, antigen-based technology, applied in the field of Western blotting, can solve the problems of increased detection costs, time-consuming and laborious, etc., and achieve the effects of saving detection costs, good compatibility, and strong Western blotting reaction specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0023] The technical solutions of the present invention will be further described below through specific examples. The following examples are to further illustrate the present invention, but not to limit the scope of the present invention.
[0024] 1. MultiTag-G9 artificial gene synthesis
[0025] MultiTag-G9 contains 9 common detection tags, namely GST, HA, T7, V5, Myc, StrepII, Flag, EGFP and His tags. The specific DNA sequences are:
[0026] GST label
[0027]
[0028] HA tag
[0029] tatccgtatgatgttccggattatgca27
[0030] T7 label
[0031] atggcatcaatgacaggcggccagcagatgggc33
[0032] V5 label
[0033] ggcaaaccgattccgaatccgctgctgggcctggattcaaca42
[0034] Myc Tags
[0035] gaacagaaactgatttcagaagaagatctg30
[0036] Strep II label
[0037] tggtcacatccgcagtttgaaaaa24
[0038] Flag tag
[0039] gattataaagatgatgatgataaa24
[0040] EGFP tag
[0041]
[0042]
[0043] His tag
[0044] catcatcatcatcatcat18
[0045] The above nine tag DNA sequences were con...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
