Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Multi-tag antigen, and preparation method and application thereof

A multi-label, antigen-based technology, applied in the field of Western blotting, can solve the problems of increased detection costs, time-consuming and laborious, etc., and achieve the effects of saving detection costs, good compatibility, and strong Western blotting reaction specificity

Active Publication Date: 2016-02-03
YEASEN BIOTECHNOLOGY (SHANGHAI) CO LTD
View PDF3 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Commonly used tags include GST tag, HA tag, StrepII tag, Flag tag, EGFP tag, and His tag. In protein detection, different target proteins often choose different tag sequences according to their properties. In the prior art, many A single tag is used as a positive control, so when multiple proteins to be tested contain multiple different tag sequences, multiple corresponding positive controls are required, which is time-consuming and laborious, and increases the detection cost

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Multi-tag antigen, and preparation method and application thereof
  • Multi-tag antigen, and preparation method and application thereof
  • Multi-tag antigen, and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0023] The technical solutions of the present invention will be further described below through specific examples. The following examples are to further illustrate the present invention, but not to limit the scope of the present invention.

[0024] 1. MultiTag-G9 artificial gene synthesis

[0025] MultiTag-G9 contains 9 common detection tags, namely GST, HA, T7, V5, Myc, StrepII, Flag, EGFP and His tags. The specific DNA sequences are:

[0026] GST label

[0027]

[0028] HA tag

[0029] tatccgtatgatgttccggattatgca27

[0030] T7 label

[0031] atggcatcaatgacaggcggccagcagatgggc33

[0032] V5 label

[0033] ggcaaaccgattccgaatccgctgctgggcctggattcaaca42

[0034] Myc Tags

[0035] gaacagaaactgatttcagaagaagatctg30

[0036] Strep II label

[0037] tggtcacatccgcagtttgaaaaa24

[0038] Flag tag

[0039] gattataaagatgatgatgataaa24

[0040] EGFP tag

[0041]

[0042]

[0043] His tag

[0044] catcatcatcatcatcat18

[0045] The above nine tag DNA sequences were con...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a multi-tag antigen. The multi-tag antigen comprises the following nine tags: a GST tag, an HA tag, a T7 tag, a V5 tag, a Myc tag, a StrepII tag, a Flag tag, an EGFP tag and a His tag which are connected in series according to a sequence of GST-HA-T7-V5-Myc-StrepII-Flag-EGFP-His. The invention also discloses a preparation method for the multi-tag antigen and application of the multi-tag antigen in immunoblotting. The multi-tag antigen disclosed in the invention can meet demand for setting of positive contrast in most immunoblotting reactions and has good compatibility and strong immunoblotting specificity.

Description

technical field [0001] The invention relates to the field of immunoblotting, in particular to a multi-label antigen and its preparation method and application. Background technique [0002] Western blotting is a technique in which proteins are transferred to a membrane and then detected using antibodies. For the known expressed protein, the corresponding antibody can be used as the primary antibody for detection, and for the expression product of the new gene, it can be detected by the antibody of the fusion part, which has the advantages of large analysis capacity, high sensitivity, and strong specificity. One of the most commonly used methods of expression and distribution, such as the qualitative and quantitative detection of tissue antigens, the mass determination of polypeptide molecules, and the detection of virus antibodies or antigens, etc., so Western blotting technology has a wide range of applications in molecular biology research. [0003] When designing and exp...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/11C12N15/70G01N33/68C12R1/19
Inventor 曹平生
Owner YEASEN BIOTECHNOLOGY (SHANGHAI) CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com