A Molecular Identification Method for the CMS Line of Dian-1 Three-line Hybrid Japonica Rice
A hybrid japonica rice and molecular identification technology, which is applied in the field of molecular identification of the sterile line of a three-line hybrid japonica rice in Yunnan, can solve the problems of decline, the research of sterile genes is lagging behind, and the accuracy rate is reduced to 80%, and the method is simple, The effect of precise and high-accuracy molecular positioning of fertility genes
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0025] In order to further illustrate the molecular identification method of the present invention for the Dian-1 type three-line hybrid japonica rice sterile line, the specific implementation of the present invention will be further described in detail below in conjunction with the accompanying drawings and examples.
[0026] First of all, in order to ensure more accurate positioning of the molecular characteristics of the Dian-1 three-line hybrid japonica rice sterile line, and to distinguish it from the maintainer line, the restorer line and the hybrid, the patent design and synthesis of the invention uses two pairs of primers to jointly identify the system. The molecules were PCR amplified and directly sequenced. The sequences of csSPF and csSPR1 in the two pairs of primers were AACCAACGCCGACCCCAAAACA and GGCCGCCCTCCCACCTT, respectively; the sequences of the other pair of primers RFSPF2 and RFSPR21 were CCTAATTCATGGTTTGTGCACCTGTA and GCCAAGCAATATCCATTGATAAGAGTATTG, respecti...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap