A molecular marker and its application for assisted selection of mung bean resistance gene br3

A technology of molecular markers and assisted selection, which is applied in the field of crop genetics and breeding, can solve complicated problems, and achieve the effect of eliminating time-consuming and labor-intensive identification of soybean resistance

Active Publication Date: 2019-01-08
INST OF CEREAL & OIL CROPS HEBEI ACAD OF AGRI & FORESTRY SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the complicated work of identification of anti-weevil every year, there is no report on the use of V1128 as an anti-weevil gene for cultivating mung bean varieties

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A molecular marker and its application for assisted selection of mung bean resistance gene br3
  • A molecular marker and its application for assisted selection of mung bean resistance gene br3
  • A molecular marker and its application for assisted selection of mung bean resistance gene br3

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1 Determination of SYD404 Molecular Marker

[0032] Experimental Materials:

[0033] Jilu 7, which is sensitive to bean elephant, was used as the female parent, and the mung bean variety was bred by the Institute of Grain and Oil Crops, Hebei Academy of Agriculture and Forestry Sciences; Cross Jilu 7 and V1128, and harvest F 1 generation. will come from the same F 1 The seeds of a single plant propagate into F2 A total of 158 F 2 single plant. At the same time the F 1 A single plant was backcrossed with the recurrent parent Jilv 7 and obtained 105 BC 1 single plant. f 2 Randomly take 30 seedlings to plant and get F 2:3 family lineage.

[0034] Anti-soybean identification method:

[0035] For parents, F 1 , F 2 and BC 1 and F 2:3 The pedigree was identified for resistance to bean weevil. Each single plant randomly gets 90 seeds, divides into 3 repetitions, each repeats 30 seeds, puts them in diameter 5cm, high 2.5cm small plastic box (without cove...

Embodiment 2

[0049] Example 2 Verification of Molecular Markers

[0050] In order to verify the selection effect of the molecular marker SYD404 in actual breeding, according to the identification results of the resistance to C. 8 From the population of recombinant inbred lines (RILs), 20 lines resistant to and susceptible to Elephant leguminosa were randomly selected, and SSR primers (upstream primer: 5ˊACGGCTATTCATCGTTTTGC3ˊ; downstream primer: 5ˊCAACCCGAAGCCAAAAACTA 3ˊ) were used for PCR amplification verification, respectively. The sensitive parent Jilu 7 (without resistance gene) and the resistant parent V1128 (with resistance gene Br3) were used as controls.

[0051] The PCR reaction system is 10μL, containing 1×PCR buffer, 0.2mM dNTPs, 0.2μM upstream and downstream primers, 20ng Jilv 7×V1128F 8 Generation strain genomic DNA, 0.5U Taq enzyme;

[0052] PCR amplification program: pre-denaturation at 95°C for 5 min, and then each cycle: denaturation at 95°C for 30 s, annealing at 55°C ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a molecular marker for assisted selection of a green bean bruchid-resistant new gene Br3 and application of the molecular marker. The molecular marker is named as SYD404 and obtained by using genome DNA of a green bean variety V1128 as a template and adopting a pair of SSR primers for PCR (polymerase chain reaction) amplification, and a genetic distance between the molecular marker and the bruchid-resistant gene Br3 is 4.0cM. The molecular marker provides a good route for bruchid-resistant breeding of the green bean variety V1128, selection can be advanced to a green bean growth seedling stage, a lot of bruchid-resistant identification work which consumes time and labor can be avoided, early generation selection of breeding materials can be realized, and accurate successive generation tracking of target genes can be realized.

Description

technical field [0001] The invention relates to a molecular marker closely linked with the anti-weevil gene Br3 and its application in mung bean anti-weevil breeding, and the invention belongs to the technical field of crop genetic breeding. Background technique [0002] Bean weevil is a major storage pest that harms mung bean and other edible legume crops. After being harmed, the weight of the edible beans is reduced, the nutrition is lost, and the quality is seriously reduced. At present, the main method for preventing and controlling soybean weeds in production is aluminum phosphide fumigation, which not only increases the cost of edible soybean production, but also easily leads to pesticide residues, environmental pollution, and affects the health of consumers. The most economical and environmentally friendly method to prevent and control the damage of bean weevil is to cultivate edible bean varieties resistant to bean weevil. [0003] TC1966 and ACC41 are the two most...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/6895C12N15/11
CPCC12Q1/6895C12Q2600/156
Inventor刘长友田静范保杰曹志敏苏秋竹王彦张志肖
OwnerINST OF CEREAL & OIL CROPS HEBEI ACAD OF AGRI & FORESTRY SCI