Optimized CRISPR-CAS double nickase systems, methods and compositions for sequence manipulation
A sequence, target sequence technology, applied in the field of optimized CRISPR-CAS double nickase system and composition for sequence manipulation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
example 1
[0580] Example 1: Method improvements for simplified cloning and delivery.
[0581] Instead of encoding the U6-promoter and guide RNA on a plasmid, Applicants amplified the U6-promoter with DNA oligonucleotides for addition to the guide RNA. The resulting PCR product can be transfected into cells to drive expression of the guide RNA.
[0582] Exemplary primer pairs that allow generation of a PCR product consisting of a U6-promoter::guide RNA targeting the human EMX1 locus:
[0583] Forward primer: AAACTCTAGAGagggcctatttcccatgattc
[0584] Reverse primer (carries guide RNA, which is underlined):
[0585] acctctag AAAAAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGC TATGCTGTTTTGTTTCCAAAACAGCATAGCTCTAAAACCCTAGTCATTGGA GGTGACGGTGTTTCGTCCTTTCCACaag
example 2
[0586] Example 2: Method improvements for improving activity:
[0587] Instead of expressing guide RNA in eukaryotic cells using the pol3 promoter (specifically RNA polymerase III (e.g. U6 or H1 promoters), Applicants expressed T7 polymerase in eukaryotic cells to drive the expression of guide RNA using the T7 promoter Express.
[0588] An example of this system can involve the introduction of three pieces of DNA:
[0589] 1. Cas9 expression vector
[0590] 2. Expression vector of T7 polymerase
[0591] 3. Expression vector comprising guide RNA fused to the T7 promoter
example 3
[0592] Example 3: Method improvement for reducing the toxicity of Cas9: Cas9 was delivered in the form of mRNA.
[0593] Delivery of Cas9 as mRNA allows for transient expression of Cas9 in cells to reduce toxicity. For example, the following primer pairs can be used to amplify humanized SpCas9:
[0594] Forward primer (to be added to the T7 promoter for in vitro transcription): TAATACGACTCACTATAGGAAGTGCGCCACCATGGCCCCAAAGAAGAAGCGG
[0595] Reverse primer (to add to polyA tail): GGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTttcttaCTTTTCTTTTTTGCCTGGCCG
[0596] Applicants transfected Cas9 mRNA into cells with guide RNA in the form of an RNA or DNA cassette to drive expression of the guide RNA in eukaryotic cells.
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap