Primers, probe, kit and method for detecting bovine coronavirus
A coronavirus and kit technology, applied in the field of molecular biology, can solve the problems of not being able to explain whether there is bovine coronavirus in cattle, not being able to detect bovine coronavirus in a timely and accurate manner, and not being able to well meet the needs of pathogenic detection, etc. To achieve the effect of simple and practical operation, high specificity and sensitivity, and strong specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] Example 1 detects primers, probes and methods for bovine coronavirus
[0028] 1, Primer and Probe Design
[0029] Target fragment amplification: According to the bovine coronavirus N gene sequence (GB︱EU401981.1︱) published by GenBank, design quantitative PCR amplification primers, and design probe primers in the middle of the designed amplification primers, and quantitative PCR primers And the probe was synthesized by Shanghai Jikang Biotechnology Co., Ltd., the sequence is as follows:
[0030] Upstream primer: TCCTTAAGTGGGCCGATCAG (SEQ ID NO: 1)
[0031] Downstream primer: GAGCTTCTTTCACCCCTGGTTTG (SEQ ID NO: 2)
[0032] Probe: 5'FAM-CCGACCAATCTAGAAAT-3'TAMRA (SEQ ID NO:3)
[0033] The 3' end of the probe P is bound to the fluorescent quenching group TAMRA, and the 5' end of the probe P is bound to the fluorescent reporter group FAM.
[0034] 2, Detection method
[0035] Include the following steps:
[0036] (1) Extraction of sample RNA
[0037] Positive con...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap