miRNA biomarker for diagnosis of polycystic ovarian syndromes and application thereof
A biomarker, polycystic ovary technology, applied in the field of miRNA biomarkers for the diagnosis of polycystic ovary syndrome, can solve the problem of unclear pathogenic mechanism of hormones
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] Example 1 Research of miR27a on promoting apoptosis of granulosa cells, inhibiting aromatase production and imbalance of estrogen ratio in granulosa cells
[0025] (1) In vitro experiment: KK-1 cell line was cultured in vitro, divided into experimental group and control group, transfected with miR27a (i.e. miR27amimic, UUCACAGUGGCUAAGUUCCGC) and miR-NC (an irrelevant miR mimic), respectively, and detecting cell proliferation and apoptosis. Changes in apoptosis, changes in aromatase in cells and changes in estrogen content in cell supernatants.
[0026] miR-NCmimic (mimetic):
[0027] sense: UUCUCCGAACGUGUCACGUTT
[0028] antisense: ACGUGACACGUUCGGAGAATT
[0029] miR-NC inhibitor (inhibitor): CAGUACUUUUGUGUGUAGUACAA
[0030] The specific experimental operation is as follows:
[0031] 1. Effect of miR27a on hormone secretion in mice
[0032] (1) Cell transfection
[0033] Use lipofectamineTM2000 produced by Invitrogen, and operate according to the instructions (take...
Embodiment 2
[0079] Example 2 Application of miR27a as a miRNA biomarker for the diagnosis of polycystic ovary syndrome
[0080] Based on the real-time quantitative PCR method to detect the miR27a content in the ovaries of patients with polycystic ovary syndrome, the designed primer sequences are as follows:
[0081] miR27a-3p-RT:5′-CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGCGGAACT-3′
[0082] miR27a-3p-F:5′-CATCTGAGGATTCACAGTGGCTA-3′
[0083] miR27a-3p-R:5′-CTCAACTGGTGTCGTGGAGTC-3′
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 