Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

miRNA biomarker for diagnosis of polycystic ovarian syndromes and application thereof

A biomarker, polycystic ovary technology, applied in the field of miRNA biomarkers for the diagnosis of polycystic ovary syndrome, can solve the problem of unclear pathogenic mechanism of hormones

Inactive Publication Date: 2016-07-20
CHINA AGRI UNIV
View PDF0 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The research on miRNA in PCOS is currently mainly focused on insulin resistance, obesity, etc., but the pathogenic mechanism of the key factor of hormone imbalance is still unclear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • miRNA biomarker for diagnosis of polycystic ovarian syndromes and application thereof
  • miRNA biomarker for diagnosis of polycystic ovarian syndromes and application thereof
  • miRNA biomarker for diagnosis of polycystic ovarian syndromes and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Example 1 Research of miR27a on promoting apoptosis of granulosa cells, inhibiting aromatase production and imbalance of estrogen ratio in granulosa cells

[0025] (1) In vitro experiment: KK-1 cell line was cultured in vitro, divided into experimental group and control group, transfected with miR27a (i.e. miR27amimic, UUCACAGUGGCUAAGUUCCGC) and miR-NC (an irrelevant miR mimic), respectively, and detecting cell proliferation and apoptosis. Changes in apoptosis, changes in aromatase in cells and changes in estrogen content in cell supernatants.

[0026] miR-NCmimic (mimetic):

[0027] sense: UUCUCCGAACGUGUCACGUTT

[0028] antisense: ACGUGACACGUUCGGAGAATT

[0029] miR-NC inhibitor (inhibitor): CAGUACUUUUGUGUGUAGUACAA

[0030] The specific experimental operation is as follows:

[0031] 1. Effect of miR27a on hormone secretion in mice

[0032] (1) Cell transfection

[0033] Use lipofectamineTM2000 produced by Invitrogen, and operate according to the instructions (take...

Embodiment 2

[0079] Example 2 Application of miR27a as a miRNA biomarker for the diagnosis of polycystic ovary syndrome

[0080] Based on the real-time quantitative PCR method to detect the miR27a content in the ovaries of patients with polycystic ovary syndrome, the designed primer sequences are as follows:

[0081] miR27a-3p-RT:5′-CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGCGGAACT-3′

[0082] miR27a-3p-F:5′-CATCTGAGGATTCACAGTGGCTA-3′

[0083] miR27a-3p-R:5′-CTCAACTGGTGTCGTGGAGTC-3′

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a miRNA biomarker for diagnosis of polycystic ovarian syndromes.The miRNA biomarker is miR27a.Research shows that miR27a promotes apoptosis of granular cells, inhibits generation of aromatase, makes female hormones in granular cells disproportionate and leads to ovulation failures to cause polycystic ovarian syndromes.By inducing a mouse polycystic ovarian syndrome model with DHT, it is found that miR27a is highly expressed in the mouse polycystic ovarian syndrome model, and the effect of miR27a and target genes thereof in nosogenesis of polycystic ovarian syndromes is verified.miR27a can serve as a biomarker for polycystic ovarian syndromes, and a theoretical basis is provided for clinical pharmacy.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a miRNA biomarker for diagnosing polycystic ovary syndrome and its application. Background technique [0002] Worldwide infertility has become the third major disease seriously affecting human health after cancer and cardiovascular disease. Among them, female infertility accounts for 40%. In female infertility, the rate of ovulatory disorders accounts for 25%-30%. The common symptoms are polycystic ovary syndrome, premature ovarian failure, and unruptured follicle syndrome. About 10% of women of childbearing age have polycystic ovary syndrome. [0003] Polycystic ovary syndrome (PCOS) is a syndrome of endocrine disorders characterized by rare ovulation or anovulation, hyperandrogen or insulin resistance, and polycystic ovaries. Excessive androgen levels in the body caused by the imbalance of estrogen and androgen ratio are the main cause of PCOS. miRNA is an endogenous...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/113
CPCC12Q1/6883C12Q2600/158C12Q2600/178
Inventor 李向东王明明
Owner CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products