miRNA biomarker for diagnosis of polycystic ovarian syndromes and application thereof
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A biomarker, polycystic ovary technology, applied in the field of miRNA biomarkers for the diagnosis of polycystic ovary syndrome, can solve the problem of unclear pathogenic mechanism of hormones
Inactive Publication Date: 2016-07-20
CHINA AGRI UNIV
View PDF0 Cites 9 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
The research on miRNA in PCOS is currently mainly focused on insulin resistance, obesity,
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0024] Example 1 Research of miR27a on promoting apoptosis of granulosa cells, inhibiting aromatase production and imbalance of estrogen ratio in granulosa cells
[0025] (1) In vitro experiment: KK-1 cell line was cultured in vitro, divided into experimental group and control group, transfected with miR27a (i.e. miR27amimic, UUCACAGUGGCUAAGUUCCGC) and miR-NC (an irrelevant miR mimic), respectively, and detecting cell proliferation and apoptosis. Changes in apoptosis, changes in aromatase in cells and changes in estrogen content in cell supernatants.
[0030] The specific experimental operation is as follows:
[0031] 1. Effect of miR27a on hormone secretion in mice
[0032] (1) Cell transfection
[0033] Use lipofectamineTM2000 produced by Invitrogen, and operate according to the instructions (take...
Embodiment 2
[0079] Example 2 Application of miR27a as a miRNA biomarker for the diagnosis of polycystic ovary syndrome
[0080] Based on the real-time quantitative PCR method to detect the miR27a content in the ovaries of patients with polycystic ovary syndrome, the designed primer sequences are as follows:
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more
PUM
Login to view more
Abstract
The invention provides a miRNA biomarker for diagnosis of polycystic ovarian syndromes.The miRNA biomarker is miR27a.Research shows that miR27a promotes apoptosis of granular cells, inhibits generation of aromatase, makes female hormones in granular cells disproportionate and leads to ovulation failures to cause polycystic ovarian syndromes.By inducing a mouse polycystic ovarian syndrome model with DHT, it is found that miR27a is highly expressed in the mouse polycystic ovarian syndrome model, and the effect of miR27a and target genes thereof in nosogenesis of polycystic ovarian syndromes is verified.miR27a can serve as a biomarker for polycystic ovarian syndromes, and a theoretical basis is provided for clinical pharmacy.
Description
technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a miRNA biomarker for diagnosing polycystic ovary syndrome and its application. Background technique [0002] Worldwide infertility has become the third major disease seriously affecting human health after cancer and cardiovascular disease. Among them, female infertility accounts for 40%. In female infertility, the rate of ovulatory disorders accounts for 25%-30%. The common symptoms are polycystic ovary syndrome, premature ovarian failure, and unruptured follicle syndrome. About 10% of women of childbearing age have polycystic ovary syndrome. [0003] Polycystic ovary syndrome (PCOS) is a syndrome of endocrine disorders characterized by rare ovulation or anovulation, hyperandrogen or insulin resistance, and polycystic ovaries. Excessive androgen levels in the body caused by the imbalance of estrogen and androgen ratio are the main cause of PCOS. miRNA is an endogenous...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to view more 
Login to view more