Crispr/cas9 system and its application of the trp gene of Bemisia tabaci med cryptic species
A technology of Bemisia tabaci and genes, applied in the field of genetic engineering, can solve problems such as difficulty in achieving long-lasting and stable effects, off-target effects, and limited technical effects
- Summary
 - Abstract
 - Description
 - Claims
 - Application Information
 
 AI Technical Summary 
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0016] Example 1: Establishment of CRISPR / Cas9 system of Bemisia tabaci MED cryptic species
[0017] 1. Design of sgRNA primers:
[0018] Design the sgRNA target site of the TRP gene sequence of the Bemisia tabaci MED cryptic species. The design of the sgRNA target site needs to be repeatedly optimized to overcome the off-target effect. The series of optimization measures in the present invention include deleting the last 12 bases or NGG of the target sequence The fragments where the PAM fragments fit together. Primers were synthesized by Shanghai Sangon Bioengineering Technology Service Co., Ltd.
[0019] Primer BtTRP-F: GAAATTAATACGACTCACTATAGGACCAGGAGAGAGGCAAACTCGTTTTGAGCTAGAAATAGC;
[0020] Primer sgRNA-R: AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC.
[0021] 2. Synthesis of sgRNA:
[0022] (1) Use Phusion polymerase (New England Biolabs) mixed with HF buffer to perform a 30 μL system template-free PCR reaction, specifically: HF buf...
PUM
 Login to View More Abstract
Description
Claims
Application Information
 Login to View More - R&D
 - Intellectual Property
 - Life Sciences
 - Materials
 - Tech Scout
 
- Unparalleled Data Quality
 - Higher Quality Content
 - 60% Fewer Hallucinations
 
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



