Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Crispr/cas9 system and its application of the trp gene of Bemisia tabaci med cryptic species

A technology of Bemisia tabaci and genes, applied in the field of genetic engineering, can solve problems such as difficulty in achieving long-lasting and stable effects, off-target effects, and limited technical effects

Active Publication Date: 2019-03-12
INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the CRISPR / Cas9 system has the problem of off-target effects, which limits its technical effect of inhibiting the expression of target genes from the nuclear gene level, and it is difficult to achieve a lasting and stable effect

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Crispr/cas9 system and its application of the trp gene of Bemisia tabaci med cryptic species
  • Crispr/cas9 system and its application of the trp gene of Bemisia tabaci med cryptic species
  • Crispr/cas9 system and its application of the trp gene of Bemisia tabaci med cryptic species

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0016] Example 1: Establishment of CRISPR / Cas9 system of Bemisia tabaci MED cryptic species

[0017] 1. Design of sgRNA primers:

[0018] Design the sgRNA target site of the TRP gene sequence of the Bemisia tabaci MED cryptic species. The design of the sgRNA target site needs to be repeatedly optimized to overcome the off-target effect. The series of optimization measures in the present invention include deleting the last 12 bases or NGG of the target sequence The fragments where the PAM fragments fit together. Primers were synthesized by Shanghai Sangon Bioengineering Technology Service Co., Ltd.

[0019] Primer BtTRP-F: GAAATTAATACGACTCACTATAGGACCAGGAGAGAGGCAAACTCGTTTTGAGCTAGAAATAGC;

[0020] Primer sgRNA-R: AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC.

[0021] 2. Synthesis of sgRNA:

[0022] (1) Use Phusion polymerase (New England Biolabs) mixed with HF buffer to perform a 30 μL system template-free PCR reaction, specifically: HF buf...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of genetic engineering, in particular to a CRISPR / cas9 (clustered regularly interspaced short palindromic repeats / associated proteins) system of a bemisia tabaci MED cryptic species TRP gene and an application of the CRISPR / cas9 system. By overcoming an off-target effect by optimizing a synthetic primer of a target site of sgRNA of a bemisia tabaci MED cryptic species TRP sequence, the expression of a target gene can be inhibited from a nuclear gene level, so that a durable and stable effect is achieved and a durable and stable mutant type is formed.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to a CRISPR / cas9 system of the TRP gene of the Bemisia tabaci MED cryptic species and its application. Background technique [0002] The whitefly Bemisia tabaci (Gennadius) belongs to the family Aleyrodidae of the order Hemiptera, and belongs to the genus Bemisia, which is a worldwide invasive pest. Among them, the cryptic species of Bemisia tabaci MED was first discovered in Kunming, Yunnan, China in 2003. So far, it has spread to almost all provinces in the country, and has gradually replaced the cryptic species of Bemisia tabaci MEAM1, becoming the main cryptic species of Bemisia tabaci that endangers crops in my country. The strong resistance of MED cryptic species to temperature is one of the key factors for it to spread into an important pest in the world and gradually replace other cryptic species in my country, and it is one of the important mechanisms for its invasion and...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/11C12N15/89
CPCC07K14/43563C12N15/89
Inventor 吕志创王原刘万学万方浩
Owner INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com