Chimeric antigen receptor capable of simultaneously targeting CD19 and CD20 and application of chimeric antigen receptor

A technology of chimeric antigen receptor and CD20, which is applied in the field of biomedicine, can solve the problems of general treatment effect, recurrence or ineffectiveness of lymphoma, and achieve the effect of preventing off-target effects

Active Publication Date: 2021-10-26
INST OF HEMATOLOGY & BLOOD DISEASES HOSPITAL CHINESE ACADEMY OF MEDICAL SCI & PEKING UNION MEDICAL COLLEGE
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Therefore, in order to solve the problem that CD19 CAR-T technology has a general therapeutic effect on lymphoma, and the recurrence or ineffectiveness occurs due to escape mechanisms during treatment, it is necessary to find a new chimeric antigen receptor

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Chimeric antigen receptor capable of simultaneously targeting CD19 and CD20 and application of chimeric antigen receptor
  • Chimeric antigen receptor capable of simultaneously targeting CD19 and CD20 and application of chimeric antigen receptor
  • Chimeric antigen receptor capable of simultaneously targeting CD19 and CD20 and application of chimeric antigen receptor

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0088] Example 1: Linking CD19 scFv and CD20 scFv antigen recognition domains

[0089] 1. Design primers to amplify CD19scFv domain and CD20scFv domain by PCR respectively. Primers are as follows:

[0090] 19F1:CTAGCTAGCGATATTGTGCTGACCCAG19R1:GCTCAATGTCCTTAGCAGCGGCTTCCTTAGCAGCGGCTTCCTTA GCAGCGGCTTCCTTAGCAGCGGCTTCCTTAGCAGCGGCTTCGCTGCTCACTGTCAGGGTGGT20F1:AGTGAGCAGCGAAGCCGCTGCTAAGGAA GCCGCTGCTAAGGAA GCCGCTGCTAAGGAAGCCGCTGCTAAGGAAGCCGCTGCTAAGGACATTGA GCTCACCCAGTC20R1:CCGGAATTCTGAGGAGACGGTGACCGTG19F2:ACCAAGCTGGAAATCAAAGGTGGTGGTGGTTCTGGCGGCGGCG GCTCCGGTGGTGGTGGTTCTGAGGTGAAGCTG19R2:CCGGAATTCGCTGCTCACTGTCAGGGTG20F2:CTAGCTAGCGACATCGAGCTCACTCAG20R2:CAGCTTCACCTCAGAACCACCACCACCGGAGCCGCCGCCGCCAGAACCACCACCACCTTTGATTTCCAGCTTGGT

[0091] 2. Use 19F1 and 19R1, 19F2 and 19R2 as two pairs of primers to amplify CD19scFv to obtain two fragments 19-1 and 19-2; use 20F1 and 20R1, 20F2 and 20R2 as two pairs of primers to amplify CD20scFv to obtain 20 -1 and 20-2 two fragments.

[0092] Prepare the ...

Embodiment 2

[0120] Example 2: Construction of Chimeric Antigen Receptor Vector

[0121] 1. Use Nhe I, EcoR I endonuclease to digest the plasmid containing CD8α-4-1BB-CD3ζ fragment (source CD19CAR), obtain CD8α-4-1BB-CD3ζ fragment, its amino acid sequence is as shown in SEQ ID NO.12 Show. The plasmid containing the CD8α-4-1BB-CD3ζ fragment can be prepared by any suitable method in the prior art.

[0122] 2. Ligate the tan1920 scFv, tan2019 scFv, loop1920 scFv, and loop2019 scFv fragments obtained in Example 1 with the target vector to obtain the corresponding CAR expression vector. The constructed CAR expression vector was identified by digestion with XbaI and NotI. The result is as image 3 As shown, the enzyme digestion results showed that the positive clone contained the target band and was correctly identified by sequencing. The schematic diagram of the carrier is as Figure 4 Show.

Embodiment 3

[0123] Example 3: Preparation of chimeric antigen receptor CD22 scFv-CD8α-4-1BB-CD3ζ lentivirus modified T cells

[0124] 1. Use EndoFree Plasmid Maxi Plasmid Extraction Kit (QIAGEN Company) to extract tan1920 CAR, tan2019 CAR, loop1920 CAR, loop2019 CAR expression plasmids and packaging plasmids pMDLg / pRRE, pRSV-Rev, pMD2G four plasmids with 3:1:1 :1 ratio was transfected with PEI transfection reagent (polyscience company) (see the manual of PEI transfection reagent for specific methods). Replace the fresh culture medium 12 hours after transfection, collect the virus supernatant 24 hours and 48 hours later, centrifuge at 4°C, 3000rpm for 15 minutes, filter through a 0.45μm filter, and use 50000g, 4°C, 1.5 hours after ultracentrifugation Concentrate 10 times, then transfer to -80°C for storage.

[0125] 2. Preparation of T cells: Take 10 ml of fresh healthy human peripheral blood, and use RosetteSep T cell enrichment Cocktail (Stemcell) and Ficoll-Paque PLUS (GE Healthcare) t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a nucleic acid molecule for coding a chimeric antigen receptor capable of simultaneously targeting CD19 and CD20. The chimeric antigen receptor comprises an extracellular region, a transmembrane region and an intracellular signal transduction region, wherein the extracellular region coded by the chimeric antigen receptor comprises CD19 and CD20 binding structural domains, and the CD20 binding structural domain in the CD19 and CD20 binding structural domains is an amino acid sequence as shown in SEQ ID NO.2. Experiments prove that the T cell modified by the chimeric antigen receptor has a strong killing effect on CD19 <+>, CD20 <+> and CD19 <+> / CD20 <+> B cell lymphoma cells and B cell lymphoma leukemia cells, almost has no killing effect on cells which do not express CD19 and CD20, and effectively prevents an off-target effect. The chimeric antigen receptor disclosed by the invention can be used for treatment of CD19 + B cell and CD20 + B cell hematologic tumors and combined treatment with CD19 CAR-T cells or CD20 CAR-T cells.

Description

technical field [0001] The invention relates to the technical field of biomedicine, in particular to a chimeric antigen receptor targeting both CD19 and CD20 and its application. Background technique [0002] Chimeric antigen receptor (CAR)-modified T cells, as an immunotherapeutic strategy, have received extensive attention and application in tumor therapy. The structure of CAR generally consists of four parts: an extracellular targeting linker region (usually a single-chain antibody with antigen recognition function), a hinge region, a transmembrane region, and an intracellular signal transduction region. Currently, according to the number of co-stimulatory molecules added to the intracellular signal transduction region, CARs are divided into one generation (no co-stimulatory molecule), second generation (with one co-stimulatory molecule) and third-generation (with two co-stimulatory molecules). The second-generation CAR is currently the most widely used. [0003] The ap...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K19/00C12N15/62A61K39/00A61P35/00
CPCC07K14/7051C07K16/2887C07K16/2803A61K39/001112A61K39/001124A61P35/00C07K2319/02C07K2319/03A61K2039/5158
Inventor王建祥王敏熊冬生陈兆琪徐颖茜饶青廖晓龙
OwnerINST OF HEMATOLOGY & BLOOD DISEASES HOSPITAL CHINESE ACADEMY OF MEDICAL SCI & PEKING UNION MEDICAL COLLEGE