Coding gene having (+)gamma-lactamase activity, and applications thereof
A technology of lactamase and encoding gene, applied in the field of enzyme engineering, can solve the problems of high cost, cumbersome chemical method and the like
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0022] The preparation method of the present invention is specified below in conjunction with the examples, if no special instructions, all are conventional methods:
[0023] The (+) gamma-lactamase provided by the present invention is called PSlac, and it is derived from Pseudomonas solanacearum ( Pseudomonas solanacearumNCIB 40249).
[0024] The above-mentioned (+) γ-lactamase PSlac is obtained by the following method: culturing Pseudomonas solanacearum to obtain bacterial cells, and extracting the total DNA of the bacterial cells. The total DNA is used as a template, and the artificially synthesized sequence is used as upstream and downstream primers for PCR, and a protein gene expression vector is constructed, and the constructed expression vector is introduced into a host cell to express (+) γ-lactamase PSlac.
[0025] Upstream primer: T CCATG GGAATTAAGTTACCCACATTG 27
[0026] The underline in the upstream primer is Nco Ⅰ Restriction site,
[0027] Downstream p...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 