Unlock instant, AI-driven research and patent intelligence for your innovation.

Coding gene having (+)gamma-lactamase activity, and applications thereof

A technology of lactamase and encoding gene, applied in the field of enzyme engineering, can solve the problems of high cost, cumbersome chemical method and the like

Active Publication Date: 2016-12-21
SUZHOU KAIYUAN MINSHENG SCI & TECH CORP
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The current synthesis methods mainly include chemical method and biological method. The chemical method is cumbersome and costly, while the biological enzymatic method has a series of advantages such as high efficiency, low energy consumption, and low cost.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Coding gene having (+)gamma-lactamase activity, and applications thereof
  • Coding gene having (+)gamma-lactamase activity, and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0022] The preparation method of the present invention is specified below in conjunction with the examples, if no special instructions, all are conventional methods:

[0023] The (+) gamma-lactamase provided by the present invention is called PSlac, and it is derived from Pseudomonas solanacearum ( Pseudomonas solanacearumNCIB 40249).

[0024] The above-mentioned (+) γ-lactamase PSlac is obtained by the following method: culturing Pseudomonas solanacearum to obtain bacterial cells, and extracting the total DNA of the bacterial cells. The total DNA is used as a template, and the artificially synthesized sequence is used as upstream and downstream primers for PCR, and a protein gene expression vector is constructed, and the constructed expression vector is introduced into a host cell to express (+) γ-lactamase PSlac.

[0025] Upstream primer: T CCATG GGAATTAAGTTACCCACATTG 27

[0026] The underline in the upstream primer is Nco Ⅰ Restriction site,

[0027] Downstream p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides a (+)gamma-lactamase having racemic splitting gamma-lactamase activity and a coding gene of (+)gamma-lactamase. According to the present invention, the gene is derived from pseudomonas solanacearum, the coding gene is obtained through a cloning expression method, and the (-)gamma-lactamase is expressed in recombinant escherichia coli through gene recombinant expression; and the bacterial splitting results prove that the (-)gamma-lactamase has the absolute corresponding selectivity, and is used for splitting (+ / -)gamma-lactam to prepare the (-)gamma-lactam with the optical purity of more than 99.8%, wherein the yield is more than 44%.

Description

technical field [0001] The invention belongs to the field of enzyme engineering, in particular to a coding gene with (+) gamma-lactamase activity and the application of the (+) gamma-lactamase coded by the gene. Background technique [0002] The biological resolution of microorganisms refers to the use of enzymes or other bacteria containing active enzymes to selectively react with one of the enantiomers of the racemate to convert it into other compounds. There are differences in physical and chemical properties, so that the racemate is resolved and separated. This kind of biological resolution has strict stereoselectivity, and the enantiomeric excess value (e.e. value) of the product is very high, and is suitable for various pharmacological tests and activity studies. At the same time, the separation and purification of its products are simple and have few side reactions; The temperature, pH value, and pressure are mild, and the production safety is high. Bioresolution is...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/86C12N15/55C12P41/00C12P13/02
CPCC12N9/86C12P13/02C12P41/001
Inventor 宋亮李岩赵飞余志强黄忠林
Owner SUZHOU KAIYUAN MINSHENG SCI & TECH CORP