Recombinant Escherichia coli displaying pet decomposing enzyme on the cell surface and its construction and application

A technology for recombining Escherichia coli and cell surface, applied in the field of genetic engineering of enzymes, can solve problems such as slow degradation rate, long growth cycle, popularization and application of restriction enzymes, etc. simple effect

Active Publication Date: 2019-06-25
TIANJIN UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the limited enzyme production ability of wild strains, long growth cycle and slow degradation rate, the popularization and application of this enzyme is greatly limited.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant Escherichia coli displaying pet decomposing enzyme on the cell surface and its construction and application
  • Recombinant Escherichia coli displaying pet decomposing enzyme on the cell surface and its construction and application
  • Recombinant Escherichia coli displaying pet decomposing enzyme on the cell surface and its construction and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1: Construction and application of recombinant Escherichia coli (BL21 / pET22bNP) displaying PET decomposing enzyme on the cell surface

[0034] Chemically synthesize the inaK-N gene as shown in SEQ ID No.2 as the anchor protein, and chemically synthesize the PETase gene as shown in SEQ ID No.1;

[0035] Primers were designed using the inaK-gene sequence and PETase gene sequence as templates.

[0036] Upstream primer inaK-NF1 5'G GAATTC CATATGACACTTGATAAGGCGC 3' (the underlined part is the NdeI restriction site)

[0037] Downstream primer inaK-NR1 5'ATAAGGATTGGTTTGAGTCTGTAAGTTCTGAGGGG 3'

[0038] Upstream primer inaK-NF2: 5'CAGAACTTACAGACTCAAACCAATCCTTATGCCC 3'

[0039] Downstream primer inaK-NR2:5'CC CTCGAG GCTACAGTTGGCGGTACGA 3' (the underlined part is the XhoI restriction site)

[0040] The target genes inaK-N and PETase were obtained by PCR amplification using artificially synthesized inaK-N gene and PETase gene as templates. The PCR reaction parameter...

Embodiment 2

[0061] Example 2: Construction and application of recombinant Escherichia coli (BL21 / pET22bLOP) displaying PET decomposing enzyme on the cell surface

[0062] Chemically synthesize the anchor protein Lpp-OmpA gene shown in SEQ ID No.3, and chemically synthesize the PETase gene shown in SEQ ID No.1;

[0063] Primers were designed using Lpp-OmpA gene sequence and PETase gene sequence as templates.

[0064] Upstream primer LOP-F1 5'GGTCTTC CATATG AAAGCTACTAAACTGGTAC 3' (the underlined part is the NdeI restriction site)

[0065] Downstream primer LOP-R1 5'CACTACCTCCACCACCGTTGTCCGGACGAGTG 3'

[0066] Upstream primer LOP-F2: 5'CACTCGTCCGGACAACGGTGGTGGAGGTAGTG 3'

[0067] Downstream primer LOP-R2:5'CC CTCGAG GCTACAGTTGGCGGTACGA 3' (the underlined part is the XhoI restriction site)

[0068] Using artificially synthesized Lpp-OmpA gene and PETase gene as templates, the target genes Lpp-OmpA and PETase were obtained by PCR amplification. The PCR reaction parameters were: pre-den...

Embodiment 3

[0089] Example 3: Construction and application of recombinant Escherichia coli (BL21 / pET22bBP) displaying PET decomposing enzyme on the cell surface

[0090] Chemically synthesize the BrkA gene shown in SEQ ID No.4 as the anchor protein, and chemically synthesize the PETase gene shown in SEQ ID No.1;

[0091] Primers were designed using the BrkA gene sequence and the PETase gene sequence as templates.

[0092] Upstream primer BrkA1 5'G GAATTC CATATGTACTTGGATCGTTTTCGGCA3' (the underlined part is the NdeI restriction site)

[0093] Downstream primer BrkA2 5'ATAAGGATTGGTTTGCCCGGCGTCCTGAGCATGT3'

[0094] Upstream primer BrkA3 5'ATGCTCAGGACGCCGGGCAAACCAATCCTTATGCC3'

[0095] Downstream primer BrkA4 5'GAGATATTCCGGCGCTACAGTTGGCGGTACGA3'

[0096] Upstream primer BrkA5 5'GCCAACTGTAGCGCCGGAATATCTCTTAGTGTT3'

[0097] Downstream primer BrkA6 5'CCG CTCGAG TCAAAACGAGTACCGATAGCC 3' (the underlined part is the XhoI restriction site)

[0098] The artificially synthesized BrkA gene and...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses recombinant escherichia coli for a cell surface display PET lytic enzyme, a construction and an application. A construction method thereof comprises the following steps: (1) chemically compounding ankyrin and PETase gene; (2) utilizing PCR to connect the ankyrin with the PETase gene, thereby acquiring a fused sequence; (3) connecting the fused sequence with an escherichia coli expression vector, thereby acquiring a fused expression vector; and (4) transferring the fused expression vector into expression host escherichia coli, thereby acquiring the recombinant escherichia coli for the cell surface display PET lytic enzyme. According to the construction method provided by the invention, the PETase with the objective protein having a PET degrading function is positioned to the cell surface through inaK-N, BrkA, AIDA or Lpp-OmpA ankyrin and has the characteristic of high catalytic activity, so that the problems of limited capacity of generating PETase, long growth period and low degradation rate of the wild bacterial strain can be solved; the enzyme does not need to be separated and purified; and the preparation and the use are simple.

Description

technical field [0001] The invention belongs to the technical field of enzyme genetic engineering, and relates to a recombinant Escherichia coli displaying PET decomposing enzyme on the cell surface and its construction and application. Background technique [0002] Today's plastic products are widely used in industrial production and daily life due to their cheap and convenient features. While providing us with convenience, they also bring serious environmental pollution problems. Among them, polyethylene terephthalate (PET) is an important plastic product, such as many kinds of beverage bottles that are common in life contain PET. [0003] In March 2016, Japanese scientists discovered that the bacterium Ideonella sakaiensis can use PET as the main carbon source and energy source. The strain can produce a decomposing enzyme that can catalyze the decomposition of PET to produce ethylene glycol (TPA), terephthalic acid (MHET) and (2-hydroxyethyl) terephthalic acid, called po...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/70C12N1/21A62D3/02A62D101/28
CPCA62D3/02A62D2101/28C12N9/14C12N15/70
Inventor王泽方杨海涛王遨王时超董国修何春霖王浩栋陈卓芝
OwnerTIANJIN UNIV