Aptamer electrochemical biosensor for detecting malachite green and preparation method thereof

A malachite green and aptamer technology, applied in the field of biosensors, can solve the problems of false positives in detection results, reduce costs, etc., and achieve the effects of simple preparation procedures and detection methods, wide linear range, and rapid detection.

Active Publication Date: 2018-10-23
BEIJING UNIV OF CHEM TECH +1
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The purpose of the present invention is to provide an aptamer electrochemical biosensor for detecting malachite green and its preparation method, which solves the problem that the detection result is prone to false positives and greatly reduces the cost

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Aptamer electrochemical biosensor for detecting malachite green and preparation method thereof
  • Aptamer electrochemical biosensor for detecting malachite green and preparation method thereof
  • Aptamer electrochemical biosensor for detecting malachite green and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] An aptamer electrochemical biosensor for detecting malachite green, including a recognition element and a transducer; the recognition element is a single-stranded DNA aptamer with a sequence of GGATCCCGACTGGCGAGAGCCAGGTAACGAATGGATCC, containing 38 bases, and the 5' end is modified-SH- (CH 2 ) 6 ‐, the electroactive substance methylene blue (MB) is modified at the 3' end as a beacon molecule; the transducer is a commonly used electrochemical transducer, and the working electrode is a gold electrode modified with the above-mentioned malachite green single-stranded DNA aptamer , the counter electrode is Pt, the reference electrode is Ag / AgCl; the detection bottom solution is phosphate buffer solution.

[0027] A method for preparing an aptamer electrochemical biosensor for detecting malachite green, comprising the following steps:

[0028] (1) Polish the gold electrode on a polishing cloth with 0.05 μm alumina powder for 2 minutes, ultrasonically clean it three times wit...

Embodiment 2

[0036] An aptamer electrochemical biosensor for detecting malachite green, including a recognition element and a transducer; the recognition element is a single-stranded DNA aptamer with a sequence of GGATCCCGACTGGCGAGAGCCAGGTAACGAATGGATCC, containing 38 bases, and the 5' end is modified-SH- (CH 2 ) 6 ‐, the electroactive substance methylene blue (MB) is modified at the 3' end as a beacon molecule; the transducer is a commonly used electrochemical transducer, and the working electrode is a gold electrode modified with the above-mentioned malachite green single-stranded DNA aptamer , the counter electrode is Pt, the reference electrode is Ag / AgCl; the detection bottom solution is phosphate buffer solution.

[0037] A method for preparing an aptamer electrochemical biosensor for detecting malachite green, comprising the following steps:

[0038] (1) Polish the gold electrode on a polishing cloth with 0.05 μm alumina powder for 2 minutes, ultrasonically clean it three times wit...

Embodiment 3

[0045] An aptamer electrochemical biosensor for detecting malachite green, including a recognition element and a transducer; the recognition element is a single-stranded DNA aptamer with a sequence of GGATCCCGACTGGCGAGAGCCAGGTAACGAATGGATCC, containing 38 bases, and the 5' end is modified-SH- (CH 2 ) 6 ‐, the electroactive substance methylene blue (MB) is modified at the 3' end as a beacon molecule; the transducer is a commonly used electrochemical transducer, and the working electrode is a gold electrode modified with the above-mentioned malachite green single-stranded DNA aptamer , the counter electrode is Pt, the reference electrode is Ag / AgCl; the detection bottom solution is phosphate buffer solution.

[0046] A method for preparing an aptamer electrochemical biosensor for detecting malachite green, comprising the following steps:

[0047] (1) Polish the gold electrode on a polishing cloth with 0.05 μm alumina powder for 2 minutes, ultrasonically clean it three times wit...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides an aptamer electrochemistry biosensor capable of detecting malachite green and a preparation method thereof and belongs to the technical field of biosensors. A single-chain DNA aptamer is adopted as a recognition element and contains 38 basic groups, and methylene blue which is modified with -SH-(CH2)6- at the 5' end and modified with an electroactive substance at 3' end is utilized as a beacon molecule. The aptamer is fixed to the surface of a gold electrode through an Au-S bond; methylene blue is utilized as an electrochemical response signal, and the diamond green and the aptamer interact to change the spatial configuration of the aptamer, so that electrochemical signals become stronger, and thus rapid detection on diamond green is realized. The aptamer electrochemistry biosensor has the advantages that the aptamer is economical in price and easy to mark; the sensor is simple in preparation process and detection method, and can be applied to accurately and rapidly detecting the malachite green with high sensitivity on site in water.

Description

technical field [0001] The invention belongs to the technical field of biosensors, in particular to an aptamer electrochemical biosensor for detecting malachite green and a preparation method thereof. It can be used for the detection of malachite green in fishery production. Background technique [0002] Malachite green (Malachite green, MG for short), belongs to triphenylmethane dyes, and its metabolism is colorless malachite green. Therefore, it has become the "fishing medicine" favored by many farmers to use, but these two substances have side effects such as high toxin, high residue, high teratogenicity and mutagenicity, and have become a major food safety hazard. At present, malachite green is listed as a prohibited fishing drug in my country, and the existing determination methods mainly include high performance liquid chromatography, gas chromatography-mass spectrometry, and liquid chromatography-mass spectrometry. These methods have the disadvantages of cumbersome ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): G01N27/48G01N27/327
CPCG01N27/327G01N27/48
Inventor 陈旭朱万军吴立冬付啸辰杨文胜
Owner BEIJING UNIV OF CHEM TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap