A rubber tree flowering regulation gene hbft2 and its cloning and application
A technology of flowering regulation and rubber tree, which is applied in the field of genetic engineering and can solve problems that have not been reported
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] The acquisition of embodiment 1 Hevea brasiliensis flowering regulation gene HbFT2
[0040] Analyze the cDNA sequences of the FT genes of Arabidopsis thaliana and castor bean that have been registered in NCBI, search the established rubber tree leaf transcriptome database, obtain fragment information through homologous comparison, and then splice, and then predict the open read and Design specific primers to obtain DNA sequences and cDNA sequences containing complete open reading frames. The specific method is as follows:
[0041] (1) Acquisition of the open reading frame of the HbTF2 gene
[0042] Gene-specific primers were designed as follows:
[0043] HbFT2OF: GGAATTCATGCCTAGAGATCCTCTGGTT;
[0044] HbFT2OR: CCCCCCGGGTTGTCCTCGCCTTCTT.
[0045] Using Hevea brasiliensis Reyan 7-33-97 (cultivated by Rubber Research Institute of Chinese Academy of Tropical Agricultural Sciences) leaf and inflorescence cDNA mixture as template (obtained by reverse transcription with ra...
Embodiment 2
[0069] Example 2 Hevea HbFT2 Gene Tissue-Specific Expression Analysis
[0070] In this study, various vegetative tissues and reproductive organs (including roots, stems, bronze leaves, discolored leaves, light green leaves, discolored leaves, stable leaves, buds, first Inflorescences at the development stage, flowering male flowers, flowering female flowers) and pericarp and seeds collected in August, their RNA was extracted respectively for future use.
[0071] The RNA obtained above was digested with DnaseI and then reverse transcribed according to the reverse transcription kit. The target gene tissue-specific expression analysis was performed by fluorescence quantitative technology.
[0072] Quantitative primers are:
[0073] HbFT2-QF: ATCTTTTCTACCATTTGACCCCATA;
[0074] HbFT2-QR: ATAACTCGCCCGCTTGTAATCT.
[0075] like figure 1 The results shown show that the HbFT2 gene is mainly expressed in reproductive organs, with the highest expression in seeds, however, the expres...
Embodiment 3
[0076] Example 3 Expression patterns of HbFT2 gene in different seasons of two rubber trees of different ages
[0077]Taking the stable leaves of 2-year-old trees and 10-year-old trees as the research objects, the materials were collected in March and collected once a month until November. Afterwards, fluorescent quantitative analysis was performed on the HbFT2 gene, and the quantitative primers were the same as the aforementioned tissue-specific expression analysis primers.
[0078] like figure 2 The results shown showed that the HbFT2 gene showed similar expression patterns in two rubber trees of different ages, and was mainly expressed in March, July and November. March is the main flowering period of rubber trees, during which the expression level of HbFT2 gene in the leaves gradually decreased, gradually increased from April to July, and returned to the trough in August, and the expression level of HbFT2 gene in 10-year-old trees after September The HbFT2 gene began to...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More