Three reference genes suitable for qPCR of octopuses and universal primer thereof
An internal reference gene and animal technology, applied in the direction of microbial determination/inspection, biochemical equipment and methods, etc., can solve the problem of not being suitable for cephalopods, etc., and achieve the effect of improving stability and reliability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0010] Example 1: Application of an internal reference gene suitable for qPCR of octopus animals in real-time fluorescent quantitative PCR:
[0011] 1) According to the operating instructions of the Omega Total RNA Extraction Kit, the total RNA of the octopus was extracted, and then the cDNA was synthesized according to the operating instructions of the PrimeScript TM RT reagent kit with gDNA Eraser reverse transcription kit of TaKaRa Company;
[0012] 2) The cDNA synthesized in step 1) was analyzed and detected by fluorescent quantitative PCR. The internal reference genes used were elongationfactor-1 alpha, 18s and ubiquitin, and the nucleotide sequence of elongation factor-1 alpha was shown in SEQ ID NO.1, and the nucleotide sequence of 18s was The nucleotide sequence is shown in SEQ ID NO.2, and the nucleotide sequence of ubiquitin is shown in SEQ ID NO.3;
[0013] The upstream primer sequence for amplifying elongation factor-1 alpha gene is GTAGAGATGCACCACGAGTCACTT, and th...
Embodiment 2
[0018] Example 2: Application of an internal reference gene suitable for qPCR of octopus animals in real-time fluorescent quantitative PCR:
[0019] 1) According to the operating instructions of the Omega Total RNA Extraction Kit, the total RNA of the octopus was extracted, and then the cDNA was synthesized according to the operating instructions of the PrimeScript TM RT reagent kit with gDNA Eraser reverse transcription kit of TaKaRa Company;
[0020] 2) The cDNA synthesized in step 1) was analyzed and detected by fluorescent quantitative PCR. The internal reference genes used were elongationfactor-1 alpha, 18s and ubiquitin, and the nucleotide sequence of elongation factor-1 alpha was shown in SEQ ID NO.1, and the nucleotide sequence of 18s was The nucleotide sequence is shown in SEQ ID NO.2, and the nucleotide sequence of ubiquitin is shown in SEQ ID NO.3; the upstream primer sequence for amplifying the elongation factor-1 alpha gene is GTAGAGATGCACCACGAGTCACTT, and the downst...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com