Unlock instant, AI-driven research and patent intelligence for your innovation.

Three reference genes suitable for qPCR of octopuses and universal primer thereof

An internal reference gene and animal technology, applied in the direction of microbial determination/inspection, biochemical equipment and methods, etc., can solve the problem of not being suitable for cephalopods, etc., and achieve the effect of improving stability and reliability

Inactive Publication Date: 2018-01-16
ZHEJIANG OCEAN UNIV
View PDF1 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Cephalopoda is a marine biological species that has been widely studied in recent years, and the research on its functional genes is also in full swing. However, up to now, most of the internal reference genes of cephalopod fluorescence quantitative PCR have copied shellfish and other marine organisms, and there is still no suitable cephalopod. internal reference gene

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0010] Example 1: Application of an internal reference gene suitable for qPCR of octopus animals in real-time fluorescent quantitative PCR:

[0011] 1) According to the operating instructions of the Omega Total RNA Extraction Kit, the total RNA of the octopus was extracted, and then the cDNA was synthesized according to the operating instructions of the PrimeScript TM RT reagent kit with gDNA Eraser reverse transcription kit of TaKaRa Company;

[0012] 2) The cDNA synthesized in step 1) was analyzed and detected by fluorescent quantitative PCR. The internal reference genes used were elongationfactor-1 alpha, 18s and ubiquitin, and the nucleotide sequence of elongation factor-1 alpha was shown in SEQ ID NO.1, and the nucleotide sequence of 18s was The nucleotide sequence is shown in SEQ ID NO.2, and the nucleotide sequence of ubiquitin is shown in SEQ ID NO.3;

[0013] The upstream primer sequence for amplifying elongation factor-1 alpha gene is GTAGAGATGCACCACGAGTCACTT, and th...

Embodiment 2

[0018] Example 2: Application of an internal reference gene suitable for qPCR of octopus animals in real-time fluorescent quantitative PCR:

[0019] 1) According to the operating instructions of the Omega Total RNA Extraction Kit, the total RNA of the octopus was extracted, and then the cDNA was synthesized according to the operating instructions of the PrimeScript TM RT reagent kit with gDNA Eraser reverse transcription kit of TaKaRa Company;

[0020] 2) The cDNA synthesized in step 1) was analyzed and detected by fluorescent quantitative PCR. The internal reference genes used were elongationfactor-1 alpha, 18s and ubiquitin, and the nucleotide sequence of elongation factor-1 alpha was shown in SEQ ID NO.1, and the nucleotide sequence of 18s was The nucleotide sequence is shown in SEQ ID NO.2, and the nucleotide sequence of ubiquitin is shown in SEQ ID NO.3; the upstream primer sequence for amplifying the elongation factor-1 alpha gene is GTAGAGATGCACCACGAGTCACTT, and the downst...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses three reference genes suitable for qPCR of octopuses and the application of the genes in real-time fluorescence quantitative PCR. The beneficial effect is that the genes can bestably expressed under different environments and experimental conditions without being affected by any internal and external factors; by using elongation factor-1 alpha, 18s and ubiquitin elongationfactor-1 alpha as the reference genes to be applied to real-time fluorescence quantitative PCR, the requirement for real-time fluorescence quantitative PCR detection of the genetic transcription expression level of the octopuses can be met, and the stability and reliability of gene expression analysis and study of the octopuses are improved.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and in particular relates to three internal reference genes suitable for qPCR of octopus animals and general primers thereof. Background technique [0002] Appropriate internal reference genes are key factors for identifying accurate expression patterns of target genes in real-time fluorescent quantitative PCR (qRT-PCR). Ideal internal reference genes should have the following characteristics: expressed in all tissues and cell types, and not affected by external conditions; similar to the expression level of the target gene. Cephalopoda is a marine biological species that has been widely studied in recent years, and the research on its functional genes is also in full swing. However, up to now, most of the internal reference genes of cephalopod fluorescence quantitative PCR have copied shellfish and other marine organisms, and there is still no suitable cephalopod. An internal referenc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6888C12Q1/6851C12Q1/686
Inventor 吕振明朱科桦龚理刘炳舰刘立芹
Owner ZHEJIANG OCEAN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More