Unlock instant, AI-driven research and patent intelligence for your innovation.

Nucleic acid, kit and method for simultaneous detection of rot pathogens, yellow phytoplasmas and cluster pathogens

A technology for rot bacteria and phytoplasma, which is applied in the field of biological detection to achieve the effects of reducing pollution, good detection effect and improving sensitivity

Active Publication Date: 2019-11-08
QINGDAO AGRI UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is still a lack of high-efficiency fungicides and disease-resistant varieties for apple yellowing, rot and cluster diseases. Once infected with these four diseases, it is necessary to remove the diseased trees in time to prevent the spread of the disease. Therefore, it is particularly important to establish an early, rapid and simultaneous detection method for the detection of pathogenic bacteria that cause apple rot, yellowing and cluster diseases

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleic acid, kit and method for simultaneous detection of rot pathogens, yellow phytoplasmas and cluster pathogens
  • Nucleic acid, kit and method for simultaneous detection of rot pathogens, yellow phytoplasmas and cluster pathogens
  • Nucleic acid, kit and method for simultaneous detection of rot pathogens, yellow phytoplasmas and cluster pathogens

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] The design of embodiment 1 primer, probe

[0052] Fluorescent quantitative PCR detection is based on ordinary PCR detection, further through a specific fluorescent probe, the probe is an oligonucleotide, and the two ends are respectively labeled with a reporter fluorescent group and a quencher fluorescent group. When the probe is intact, the fluorescent signal emitted by the reporter group is absorbed by the quencher group; during PCR amplification, the 5'-3' exonuclease activity of Taq enzyme degrades the probe, so that the reporter fluorescent group and the quencher group The fluorescent group is separated, so that the fluorescence monitoring system can receive the fluorescent signal, that is, every time a DNA strand is amplified, a fluorescent molecule is formed, and the accumulation of the fluorescent signal is completely synchronized with the formation of the PCR product. Therefore, the premise of fluorescent quantitative PCR detection is to carry out PCR amplifica...

Embodiment 2

[0073] Example 2 Common PCR detection of three pathogens of rot bacteria, yellowing phytoplasma and cluster bacteria

[0074] According to Example 1, the conserved sequence in genebank sequence number AF192326 of the putrefaction bacteria screened is shown in SEQ ID No.10, and primers and probes were designed in this conserved sequence. Finally, it is determined that the fragment size amplified by the rot pathogen primers designed is 177bp, and the amplified sequence is the sequence shown in the 21st-197bp in SEQ ID No.10.

[0075] SEQ ID No. 10: TCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCAGAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCTGCTTGGTGTTGGGGCATTGCCTGAGGCCGCCCCCGGGCGGGCCGGGTAAGCCCTGAAATTAGTGGCGAGCTCGCCAGGACTCCGAGCGCAGTAGTAAAACCCTCGCTTTGGACTG.

[0076] Phytoplasma jaundice is selected as the conserved sequence with the sequence number AY197660 screened in genebank as shown in SEQ ID No.11. The primers and probes designed in this conserved sequence have a primer amplification f...

Embodiment 3 3

[0085] Embodiment 3 three kinds of pathogen fluorescence quantitative PCR detection kits

[0086] The real-time PCR detection kit for the simultaneous detection of three pathogens, rot pathogen, yellow phytoplasma and cluster pathogen, includes the following components:

[0087] Premix EX Taq×2;

[0088] The upstream primer sequence of rot pathogen is shown in SEQ ID No.1, the downstream primer sequence is shown in SEQ ID No.2, the probe sequence is shown in SEQ ID No.3, and the 5' mark TEXRED of the probe SEQ IDNo.3 , 3' mark BHQ2;

[0089] The upstream primer sequence of phytoplasma chlorosis is shown in SEQ ID No.4, the downstream primer sequence is shown in SEQ ID No.5, and the probe sequence is shown in SEQ ID No.6 wherein, the probe sequence of SEQ ID No.7 5'mark FAM, 3'mark TAMRA;

[0090] The upstream primer sequence of cluster pathogen is shown in SEQ ID No.7, the downstream primer sequence is shown in SEQ ID No.8, and the probe sequence is shown in SEQ ID No.9, wh...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention relates to a group of nucleic acids, kit and detection method for simultaneously detecting three pathogens such as valsa ceratosperma, yellows phytoplasma and rosette pathogenic bacteria. The nucleic acids used for carrying out multiple PCR (Polymerase Chain Reaction) and simultaneously detecting three pathogens comprise forward and reverse primers of the valsa ceratosperma, yellowsphytoplasma and rosette pathogenic bacteria. The nucleic acids used for carrying out fluorescent quantitative PCR and simultaneously detecting the three pathogens further comprise probes correspondingto the various pathogens. A high-efficiency and sensitive detection method capable of simultaneously detecting the three pathogens such as the valsa ceratosperma, yellows phytoplasma and rosette pathogenic bacteria is established. The method can effectively improve the detection sensitivity and avoid false negative results and can provide a technical means for effectively preventing yellows, canker and leaf spot disease.

Description

technical field [0001] The invention belongs to biological detection technology, and in particular relates to a nucleic acid, a kit and a method for simultaneously detecting rot pathogens, yellowing phytoplasma and cluster pathogens. Background technique [0002] Rot disease, also known as decay (decay), also known as rotten skin disease, stinky skin disease, etc., is a common disease that fruit trees are very prone to, and occurs all over the world. The rot disease mainly harms the branches and trunks of the fruiting trees, and it is difficult to detect in the early stage of the disease, so it is necessary to take preventive measures. In the early stage of the disease, it is not easy to identify from the outside. If you lift the skin of the branches, you can see dark brown to reddish-brown wet spots or yellowish-brown dry spots. Sometimes, the internal lesion area is already large, but it is still difficult to identify from the outside. . When the injury is severe, the co...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6895C12Q1/689C12Q1/6851C12Q1/04C12N15/11
Inventor 李伟张翠萍
Owner QINGDAO AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More