Nucleic acid, kit and method for simultaneous detection of rot pathogens, yellow phytoplasmas and cluster pathogens
A technology for rot bacteria and phytoplasma, which is applied in the field of biological detection to achieve the effects of reducing pollution, good detection effect and improving sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0051] The design of embodiment 1 primer, probe
[0052] Fluorescent quantitative PCR detection is based on ordinary PCR detection, further through a specific fluorescent probe, the probe is an oligonucleotide, and the two ends are respectively labeled with a reporter fluorescent group and a quencher fluorescent group. When the probe is intact, the fluorescent signal emitted by the reporter group is absorbed by the quencher group; during PCR amplification, the 5'-3' exonuclease activity of Taq enzyme degrades the probe, so that the reporter fluorescent group and the quencher group The fluorescent group is separated, so that the fluorescence monitoring system can receive the fluorescent signal, that is, every time a DNA strand is amplified, a fluorescent molecule is formed, and the accumulation of the fluorescent signal is completely synchronized with the formation of the PCR product. Therefore, the premise of fluorescent quantitative PCR detection is to carry out PCR amplifica...
Embodiment 2
[0073] Example 2 Common PCR detection of three pathogens of rot bacteria, yellowing phytoplasma and cluster bacteria
[0074] According to Example 1, the conserved sequence in genebank sequence number AF192326 of the putrefaction bacteria screened is shown in SEQ ID No.10, and primers and probes were designed in this conserved sequence. Finally, it is determined that the fragment size amplified by the rot pathogen primers designed is 177bp, and the amplified sequence is the sequence shown in the 21st-197bp in SEQ ID No.10.
[0075] SEQ ID No. 10: TCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCAGAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCTGCTTGGTGTTGGGGCATTGCCTGAGGCCGCCCCCGGGCGGGCCGGGTAAGCCCTGAAATTAGTGGCGAGCTCGCCAGGACTCCGAGCGCAGTAGTAAAACCCTCGCTTTGGACTG.
[0076] Phytoplasma jaundice is selected as the conserved sequence with the sequence number AY197660 screened in genebank as shown in SEQ ID No.11. The primers and probes designed in this conserved sequence have a primer amplification f...
Embodiment 3 3
[0085] Embodiment 3 three kinds of pathogen fluorescence quantitative PCR detection kits
[0086] The real-time PCR detection kit for the simultaneous detection of three pathogens, rot pathogen, yellow phytoplasma and cluster pathogen, includes the following components:
[0087] Premix EX Taq×2;
[0088] The upstream primer sequence of rot pathogen is shown in SEQ ID No.1, the downstream primer sequence is shown in SEQ ID No.2, the probe sequence is shown in SEQ ID No.3, and the 5' mark TEXRED of the probe SEQ IDNo.3 , 3' mark BHQ2;
[0089] The upstream primer sequence of phytoplasma chlorosis is shown in SEQ ID No.4, the downstream primer sequence is shown in SEQ ID No.5, and the probe sequence is shown in SEQ ID No.6 wherein, the probe sequence of SEQ ID No.7 5'mark FAM, 3'mark TAMRA;
[0090] The upstream primer sequence of cluster pathogen is shown in SEQ ID No.7, the downstream primer sequence is shown in SEQ ID No.8, and the probe sequence is shown in SEQ ID No.9, wh...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Sensitivity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



