Acetolactate decarboxylase
A technology of acetolactate decarboxylase and composition, applied in the field of acetolactate decarboxylase, capable of solving problems such as ALDC instability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
example
[0192] The present disclosure is described in further detail in the following examples, which are not intended to limit the scope of protection claimed by the present disclosure in any way. The accompanying drawings are intended to be considered an integral part of this disclosure and description. The following examples are offered to illustrate but not limit the claimed disclosure.
example 1
[0193] Example 1 - Heterologous expression of acetolactate decarboxylase, aldB
[0194] The Brevibacillus brevis (possibly called Bacillus brevis) acetolactate decarboxylase (ALDC) aldB gene was previously identified (Diderichsen et al., J Bacteriol. (1990) 172(8): 4315), whose sequence is shown in UNIPROT accession number P23616.1. The sequence of the gene aldB is depicted in SEQ ID NO:1. Nucleotides highlighted and underlined in bold are those encoding the signal peptide.
[0195] SEQ ID NO: 1 has listed the nucleotide sequence of aldB gene:
[0196] gctacaacggctactgtaccagcaccacctgccaagcaggaatccaaacctgcggttgccgctaatccggcaccaaaaaatgtactgtttcaatactcaacgatcaatgcactcatgcttggacagtttgaaggggacttgactttgaaagacctgaagctgcgaggcgatatggggcttggtaccatcaatgatctcgatggagagatgattcagatgggtacaaaattctaccagatcgacagcaccggaaaattatcggagctgccagaaagtgtgaaaactccatttgcggttactacacatttcgagccgaaagaaaaaactacattaaccaatgtgcaagattacaatcaattaacaaaaatgcttgaggagaaatttgaaaacaagaacgtcttttatgccgtaaagctgaccggtacctt...
example 4
[0229] Example 4 - Effect of Zinc on ALDC Activity
[0230] Zn during shake flask fermentation 2+ The presence
[0231] As described in Example 1, ZnSO 4 Added to culture medium for small-scale fermentations. B. subtilis transformants containing the aldB expression cassette were cultured in TSB (broth) with 300 ppm β-chloro-D-alanine (CDA) in 15 mL Falcon tubes for 5 hours, and 300 μL of the The preculture was added to each 500 mL flask containing 30 mL of CDA supplemented with 300 ppm CDA and containing 0, 5 μM, 25 μM, 50 μM, 100 μM, 200 μM, 400 μM and 800 μM Zn 2+ culture medium. The flasks were incubated at 33°C for 24 hours and 48 hours with continuous rotary mixing at 180 rpm. Cultures were harvested by centrifugation at 14500 rpm for 20 minutes in conical tubes. The culture supernatants were used for protein assays and ALDC activity assays (Table 2 and Table 3). Obviously, increasing the Zn in the fermentation medium 2+ The concentration of increased the total ...
PUM
Property | Measurement | Unit |
---|---|---|
radius | aaaaa | aaaaa |
radius | aaaaa | aaaaa |
radius | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap