Check patentability & draft patents in minutes with Patsnap Eureka AI!

Acetolactate decarboxylase

A technology of acetolactate decarboxylase and composition, applied in the field of acetolactate decarboxylase, capable of solving problems such as ALDC instability

Active Publication Date: 2018-01-26
DUPONT NUTRITION BIOSCIENCES APS
View PDF30 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, ALDC may not be stable under fermentation conditions, especially those ALDC of fermented worts with low malt content

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Acetolactate decarboxylase
  • Acetolactate decarboxylase
  • Acetolactate decarboxylase

Examples

Experimental program
Comparison scheme
Effect test

example

[0192] The present disclosure is described in further detail in the following examples, which are not intended to limit the scope of protection claimed by the present disclosure in any way. The accompanying drawings are intended to be considered an integral part of this disclosure and description. The following examples are offered to illustrate but not limit the claimed disclosure.

example 1

[0193] Example 1 - Heterologous expression of acetolactate decarboxylase, aldB

[0194] The Brevibacillus brevis (possibly called Bacillus brevis) acetolactate decarboxylase (ALDC) aldB gene was previously identified (Diderichsen et al., J Bacteriol. (1990) 172(8): 4315), whose sequence is shown in UNIPROT accession number P23616.1. The sequence of the gene aldB is depicted in SEQ ID NO:1. Nucleotides highlighted and underlined in bold are those encoding the signal peptide.

[0195] SEQ ID NO: 1 has listed the nucleotide sequence of aldB gene:

[0196] gctacaacggctactgtaccagcaccacctgccaagcaggaatccaaacctgcggttgccgctaatccggcaccaaaaaatgtactgtttcaatactcaacgatcaatgcactcatgcttggacagtttgaaggggacttgactttgaaagacctgaagctgcgaggcgatatggggcttggtaccatcaatgatctcgatggagagatgattcagatgggtacaaaattctaccagatcgacagcaccggaaaattatcggagctgccagaaagtgtgaaaactccatttgcggttactacacatttcgagccgaaagaaaaaactacattaaccaatgtgcaagattacaatcaattaacaaaaatgcttgaggagaaatttgaaaacaagaacgtcttttatgccgtaaagctgaccggtacctt...

example 4

[0229] Example 4 - Effect of Zinc on ALDC Activity

[0230] Zn during shake flask fermentation 2+ The presence

[0231] As described in Example 1, ZnSO 4 Added to culture medium for small-scale fermentations. B. subtilis transformants containing the aldB expression cassette were cultured in TSB (broth) with 300 ppm β-chloro-D-alanine (CDA) in 15 mL Falcon tubes for 5 hours, and 300 μL of the The preculture was added to each 500 mL flask containing 30 mL of CDA supplemented with 300 ppm CDA and containing 0, 5 μM, 25 μM, 50 μM, 100 μM, 200 μM, 400 μM and 800 μM Zn 2+ culture medium. The flasks were incubated at 33°C for 24 hours and 48 hours with continuous rotary mixing at 180 rpm. Cultures were harvested by centrifugation at 14500 rpm for 20 minutes in conical tubes. The culture supernatants were used for protein assays and ALDC activity assays (Table 2 and Table 3). Obviously, increasing the Zn in the fermentation medium 2+ The concentration of increased the total ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
radiusaaaaaaaaaa
radiusaaaaaaaaaa
radiusaaaaaaaaaa
Login to View More

Abstract

The present disclosure provides methods, compositions, apparatuses and kits comprising ALDC enzymes having a better stability and / or activity, and, optionally, the yield of ALDC enzymes which can be recovered from microorganisms is improved. In some embodiments, the present disclosure provides methods, apparatuses, compositions and kits for the use of metal ions to increase stability and / or activity, and which further can be used to recover the enzymes from microorganisms in improved yields.

Description

[0001] Cross References to Related Applications [0002] This application claims U.S. Provisional Patent Application No. 62 / 165671, filed May 22, 2015; U.S. Provisional Patent Application No. 62 / 166610, filed May 26, 2015; and U.S. Provisional Patent Application No. Provisional Patent Application No. 62 / 168406; Priority and Benefit of Each Provisional Application entitled "ALDC". [0003] Incorporated by reference into the sequence listing [0004] The Sequence Listing provided as a file of 16,666 bytes in size and named "20160505_NB40736_PCT_SEQS_ST25.txt" to be created and submitted concurrently on May 5, 2016 is hereby incorporated by reference in its entirety. Background of the invention [0005] Diacetyl is sometimes an undesired by-product of the fermentation of carbohydrate-containing substances (eg, wort or grape juice). The formation of diacetyl is the most detrimental because diacetyl has a strong and unpleasant odor and during beer fermentation even small amoun...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/88
CPCC12G1/0203C12Y401/01005C12N9/88C12C5/00C12C5/004C12G2200/15C12N1/38C12N9/96Y02E50/10
Inventor J·F·克拉米尔L·B·詹森A·H·凯利特-史密斯T·布拉特S-K·李
Owner DUPONT NUTRITION BIOSCIENCES APS
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More