Supercharge Your Innovation With Domain-Expert AI Agents!

Application of cotton ghlecrk1 gene in plant resistance to Verticillium wilt

An anti-Verticillium wilt, gene technology, applied in the fields of application, plant products, genetic engineering, etc., can solve the problem of unseen LecRK gene function, etc.

Active Publication Date: 2021-01-29
HENAN UNIVERSITY
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] LecRK gene plays an important role in plant growth and pathogen invasion, but there is no report on the function of LecRK gene in cotton

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of cotton ghlecrk1 gene in plant resistance to Verticillium wilt
  • Application of cotton ghlecrk1 gene in plant resistance to Verticillium wilt
  • Application of cotton ghlecrk1 gene in plant resistance to Verticillium wilt

Examples

Experimental program
Comparison scheme
Effect test

experiment example 1

[0023] Experimental example 1: Cloning and bioinformatics identification of cotton GhLecRK1 gene

[0024] 1. Cloning of GhLecRK1 gene in upland cotton

[0025] ① Extract the total RNA of upland cotton TM-1 variety according to the extraction steps in the manual of Aidlab's EASYspin Plus Plant RNA Rapid Extraction Kit and reverse transcribe it into cDNA, dilute the cDNA concentration to 50-60ng / μL. Seeds of upland cotton TM-1 were provided by the Cotton Research Institute of the Chinese Academy of Agricultural Sciences.

[0026] ②In the upland cotton genome database released by Nanjing Agricultural University (http: / / mascotton.njau.edu.cn / ), the L-type LecRK family genes were identified and expressed in the upland cotton transcriptome data. The L-type LecRK family gene whose expression level is higher in the root is numbered Gh_A09G2414, which is named GhLecRK1 in the present invention. According to the GhLecRK1 gene sequence, a pair of amplification primers are designed with ...

experiment example 2

[0037] Experimental Example 2: Analysis of the promoter sequence of GhLecRK1

[0038] The upstream 2kb sequence of GhLecRK1 was extracted from the upland cotton genome database, and the online website Plant CARE was used to predict its cis-acting elements. It was found that the upstream of the transcription start site of its promoter segment contains many cis-acting elements that respond to pathogenic bacteria and adversity stress. Such as: TC-rich repeats, the element plays an important role in responding to stress resistance and disease resistance; AREmotif responds to and regulates hypoxic or anaerobic conditions; there is also the element Box-W1 responding to fungi; cismotif responding to elicitors formula element EL1-box1. In addition, the promoter region of the gene also contains many stress-related elements that respond to hormones and light. It shows that GhLecRK1 may be involved in the regulation of various organisms, abiotics and hormones.

experiment example 3

[0039] Experimental example 3: GhLecRK1 subcellular localization

[0040] ①GhLecRK1 is located in the plasma membrane according to the prediction of subcellular localization by PSORT online software; GhLecRK1 protein has a transmembrane domain predicted by TMHMM Server v.2.0 online software.

[0041] ② Subcellular localization of GFP fusion expression

[0042] Design primers for PCR amplification of the GhLecRK1 sequence, the primers are:

[0043] F: GGGGACAAGTTTTGTACAAAAAAGCAGGCTCAATGGCTTTCCTTCTCTTCTGGTTTTATCTTC

[0044] R: GGGGACCACTTTGTACAAGAAAGCTGGGTGTCTGCCGCTGCTCATGGAACTG.

[0045] The obtained GhLecRK1 sequence was connected into the subcellular localization vector pK7FWG2.0 to construct the GhLecRK1::GFP fusion expression vector. In order to avoid affecting the transmembrane transfer of the N-terminal signal peptide guiding protein, the GFP in the vector is the C of the GhLecRK1 fragment. end connection. Using 35S-GFP as a positive control, transiently transform tob...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses the application of cotton GhLecRK1 gene in plant resistance to verticillium wilt. The nucleotide sequence of the cotton GhLecRK1 gene of the present invention is such as SEQ ID NO.1, and the amino acid sequence is such as SEQ ID NO.1; the expression of the GhLecRK1 gene of the present invention is higher in cotton roots than in other tissues, and is induced by Verticillium dahliae. If the gene is silenced in cotton, Verticillium dahliae is more likely to infect plants, and the ability of cotton to resist Verticillium wilt is reduced, indicating that it has the effect of resisting Verticillium wilt, and can be used to create new disease-resistant germplasm, thereby improving plant varieties.

Description

technical field [0001] The invention relates to the technical field of plant genetic engineering, in particular to the application of cotton GhLecRK1 gene in plant resistance to Verticillium wilt. Background technique [0002] Lectin receptor kinases LecRKs are a large subfamily of plant receptor kinases, which contain four structural domains, namely the N-terminal signal peptide (Signal peptide), extracellular lectin domain (Lectin domain), transmembrane Transmembrane domain and C-terminal serine / threonine protein kinase domain (Ser / Thr kinasedomain), lectin receptor kinases contain a hydrophobic concave ligand-binding domain, mainly used to bind carbohydrates , plant hormones such as cytokinin (Cytokinin, CTK) and other hydrophobic molecules. Previous studies have shown that LecRKs play a very important role in plant physiological and biochemical reactions, especially in plant growth and development and pathogenic bacteria invasion. [0003] Plants are multicellular euka...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/54C12N15/82A01H5/00A01H6/60
CPCC12N9/1205C12N15/8282C12Y207/01037
Inventor 蔡应繁龙璐高巍何琳张慧孙全张骁
Owner HENAN UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More