Application of cotton GbCaMBP gene in verticillium wilt resisting of plants

A technology of resistance to verticillium wilt and gene, applied in the field of plant genetic engineering, can solve the problems of affected expression and so on

Active Publication Date: 2018-02-09
HENAN UNIVERSITY
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are few reports on the function of calmodulin-binding protein genes. The main reason is that the expression of a few calmodulin-binding protein genes in Arabidopsis is affected by abiotic stresses such as temperature and osmotic stress, while that in cotton has not yet been reported. See the report

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of cotton GbCaMBP gene in verticillium wilt resisting of plants
  • Application of cotton GbCaMBP gene in verticillium wilt resisting of plants
  • Application of cotton GbCaMBP gene in verticillium wilt resisting of plants

Examples

Experimental program
Comparison scheme
Effect test

experiment example 1

[0028] Experimental example 1: Cloning and bioinformatics identification of cotton calmodulin-binding protein gene GbCaMBP

[0029] 1. Cloning of GbCaMBP gene of sea island cotton

[0030] ① According to the extraction steps in the manual of Aidlab's EASYspin Plus Plant RNA Rapid Extraction Kit, extract the total RNA of Sea Island cotton Xinhai 15 varieties and reverse transcribe it into cDNA, and dilute the cDNA concentration to 50-60ng / μL. The seeds of sea-island cotton Xinhai 15 were provided by the Cotton Research Institute of the Chinese Academy of Agricultural Sciences.

[0031] ②The EST sequence of a calmodulin-binding protein gene was screened out through transcriptome sequencing analysis, and sequenced in the sea island cotton database of Huazhong Agricultural University (http: / / cotton.cropdb.org / cotton / tools / blast.php) Alignment, a complete cDNA sequence was compared, and a pair of amplification primers (F: ATGGGATTGTCTCTTTTCATTGC; R: TTAGCCCACTGTTGCTATAG) were desi...

experiment example 2

[0039] Experimental example 2: GbCaMBP promoter sequence cloning and bioinformatics analysis

[0040] Use (https: / / phytozome.jgi.doe.gov / pz / portal.html#!search?show=BLAST) software to find out the promoter sequence of GbCaMBP online, and amplify GbCaMBP from the genomic DNA of Gymnosporum xinhai 15 A 914bp sequence upstream of the start codon (ATG) was obtained. Using the promoter transcription start site prediction software TSSP to analyze this sequence, it is predicted that the transcription start site of GbCaMBP is the 44th base upstream of ATG (+1, A).

[0041] Use (http: / / bioinformatics.psb.ugent.be / webtools / plantcare / html / ) software to predict and analyze the cis-acting elements on the promoter sequence online, and the predicted results are as follows image 3 As shown, in addition to the core promoter sequence (TATA-box and CAAT-box), the promoter sequence of GbCaMBP also contains light-sensitive elements (Box I, G-box), fungal induction response elements (Box-W1) and ...

experiment example 3

[0042] Experimental Example 3: Correlation between GbCaMBP gene and cotton resistance to Verticillium wilt

[0043] 1. Analysis of the expression pattern of GbCaMBP gene in cotton

[0044] Cotton of sea-island cotton Xinhai 15 was planted, and when the cotton seedlings grew for about 3 weeks, the cotyledon, true leaf, stem, stem tip and root of cotton were taken as samples to analyze the tissue expression pattern of GbCaMBP gene. First, extract RNA from the sample that has been taken, then reverse transcribe it into a cDNA template, and dilute it to 10-20ng / μL, and use qRT-PCR technology to organize the GbCaMBP gene using the ABI7500 Real Time PCR system (Applied Biosystems, USA) For expression pattern analysis, G. gossypii Ubiquitin 7 (UBQ7) was used as an internal reference gene.

[0045] The upstream and downstream primers of the GbCaMBP gene were designed as follows:

[0046] F: GATTGGTTGCTCGTGATGG

[0047] R: GCTTGCCCGTATGAGTTGT;

[0048] The primers for the upstream ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses application a cotton GbCaMBP gene in verticillium wilt resisting of plants. The nucleotide sequence of the cotton GbCaMBP gene is as shown in SEQ ID No. 1, and the amino acid sequence of the cotton GbCaMBP gene is as shown in SEQ ID No. 2. The fact that the verticillium wilt resistance of plants is lowered when the GbCaMBP gene is silenced in cotton and the verticillium wilt resistance of plants is increased when the GbCaMBP gene is overexpressed in Arabidopsis shows that the GbCaMBP gene has an effect of resisting verticillium wilt and can be used for creating disease-resistant new germplasm so as to improve plant varieties.

Description

technical field [0001] The invention relates to the technical field of plant genetic engineering, in particular to the application of cotton GbCaMBP gene in plant resistance to Verticillium wilt. Background technique [0002] Plants are multicellular eukaryotic organisms, which cannot move freely due to their characteristics being restricted in a specific living environment, so they will inevitably be affected by adverse factors from all sides at all times. The soil-borne pathogens Verticillium dahliae and Verticillium albo-atrum are serious fungal vascular diseases. Because it can cause the leaves of the plant to wilt and be accompanied by yellowing, the vascular tissue of the dissection pole is found to have chloasma, so this disease is called Verticillium wilt. According to statistics, more than one million mu of cotton is affected by Verticillium wilt every year in the world and suffers heavy losses. Verticillium dahliae in cotton is mainly caused by Verticillium dahli...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C12N15/82A01H5/00A01H6/60A01H6/20
CPCC07K14/415C12N15/8282
Inventor蔡应繁耿帅鹏孙全何琳龙璐高巍张骁
OwnerHENAN UNIVERSITY