Method for knocking out RBM17 gene of mesenchymal stem cells by using CRISPR-CAS system

A cell gene and stem cell technology, applied in the field of RBM17 gene editing, can solve the problem of siRNA not stable inheritance, and achieve the effect of high knockout efficiency and stable passage

Active Publication Date: 2018-03-06
上海启肽智能科技有限公司
View PDF3 Cites 28 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] The purpose of the present invention is to provide a mesenchymal stem cell that knocks out the RBM17 gene, which effectively overcomes the technical defect in the prior art that the use of siRNA for interference cannot stabilize heredity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for knocking out RBM17 gene of mesenchymal stem cells by using CRISPR-CAS system
  • Method for knocking out RBM17 gene of mesenchymal stem cells by using CRISPR-CAS system
  • Method for knocking out RBM17 gene of mesenchymal stem cells by using CRISPR-CAS system

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Embodiment 1, construction of CRISPR expression vector

[0041] gRNA design

[0042] According to the gene sequence of the target gene, through the applicant's unique optimization design method, the specific form of sgRNA obtained through specific screening is as follows:

[0043] RBM17-sgRNA1:5'to 3'gtctcagcttcaggtgaaga

[0044] RBM17-sgRNA2:5'to 3'actccaccgcatgtagcagc

[0045] RBM17-sgRNA3:5'to 3'aagacagacatgaagcaagt

[0046] RBM17-sgRNA4:5'to 3'ttccgggaggggccagggtct

[0047] RBM17-sgRNA5:5'to 3'actagagcacgagtcatctc

[0048] RBM17-sgRNA6:5'to 3'ggacttggtttggagacata

[0049] RBM17-sgRNA7:5'to 3'atgtttgtgcttacaagtac

[0050] According to the above gRNA, add CACC to its 5' end to obtain the forward oligonucleotide sequence, add AAAC to the 5' end of its complementary strand to obtain the reverse oligonucleotide sequence, and synthesize forward and reverse oligonucleotides respectively Nucleotide sequence, and then denature and anneal the synthesized sequence to ob...

Embodiment 2

[0054] Example 2 Cloning of potentiating protein CREnhancer1.0 and constructing vector

[0055] Clone the synergistic protein CREnhancer1.0 gene, obtain the gene sequence described in SEQ ID NO: 1 through the method of whole gene synthesis, use this sequence as a template, and according to the sequences of the upstream and downstream primers respectively

[0056] 5'-ATGCAGGAGAACCTGGCCCCCTG-3', 5'-CAGGCAGCTCACGCTCCTCTCG-3', primers and whole genome were synthesized by Shanghai Sangong Co., Ltd. The target gene fragment of CREnhancer1.0 gene was amplified by PCR reaction. The amplification reaction system was as follows: 95°C, 40s, 57°C, 1min, 72°C, 1min, 72°C, 10min, cycled 35 times, and the PCR product was produced by Shanghai Shenggong Co., Ltd. Sequencing was performed, and the binding was a complete match to SEQ ID NO:1 by sequencing. Subsequently, the target gene amplified by PCR was connected to the empty vector lentiviral vector pHIV-CS-CDF-CG-PRE, and the recombinant l...

Embodiment 3

[0057] Example 3 Application of CRISPR / Cas9 in bone marrow mesenchymal stem cells

[0058] CRISPR / Cas9 editing vector based on pBGN plasmid containing BSD-fsEGFP fusion gene

[0059] (1) BSD-fsEGFP fusion gene: use conventional PCR to amplify the known BSD gene, 5'-PCR primers with HindIII sites, 3'-PCR primers to introduce I-SceI and EcoRI sites. The PCR product (BSD) is inserted into the HindIII and EcoRI positions between the CMV driver and the EGFP coding region in the EGFP plasmid (the EGFP nucleotide sequence is a sequence known in the art, such as shown in sequence 1 and sequence 2 in CN105647968A) Point, generate the plasmid pBGN containing the BSD-fsEGFP fusion gene, the nucleotide sequence of the BSD-fsEGFP fusion gene is as shown in sequence 3 and sequence 4 in CN105647968A). The fusion gene is driven by CMV driver or PGK driver, but EGFP is inactive due to frameshift, so it is called fsEGFP.

[0060] 5'-PCR primers are

[0061] CTCAAGCTTAACTAAACCATGGCCAAGCCCTTTG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides RBM17 gene edition carried out on mesenchymal stem cells by adopting a CRISPR-CAS system and in particular relates to construction of a mesenchymal stem cell line with the RBM17gene knocked out. A new enhancing CREnhancer1.0 is used, and intracellular CRISPR / Cas9 gene editing efficiency can be obviously improved. The mesenchymal stem cell RBM17 knockout plasmid provided bythe invention has better genetic stability.

Description

technical field [0001] The present invention provides a CRISPR-cas system for performing RBM17 gene editing on mesenchymal stem cells, and in particular relates to the establishment of a mesenchymal stem cell line for constructing RBM17 gene knockout. Background technique [0002] Mesenchymal stem cells (MSCs) are adult stem cells with self-replication ability and multi-directional differentiation potential, which can develop into bone, cartilage, fat and other types of cells. Mesenchymal stem cells can be transplanted, and the type of cells they grow into depends on where they are injected. For example, mesenchymal stem cells injected into the heart can form healthy new tissue, among other things. [0003] Mesenchymal stem cells (MSCs) are a type of pluripotent stem cells derived from the mesoderm and ectoderm in early development. Mainly exist in connective tissue and interstitium of organs, and the content is most abundant in bone marrow tissue. Since bone marrow is its...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/85C12N15/90
CPCC07K14/47C12N9/22C12N15/113C12N15/85C12N15/907C12N2310/10C12N2800/107C12N2810/10
Inventor杨骏刘语方张立平
Owner上海启肽智能科技有限公司