Application of pgc-1α-specific RNA interference adenovirus

A PGC-1, RNA interference technology, applied in double-stranded DNA viruses, viruses, applications, etc., can solve the problems of unclear effect and less research on PGC-1α, and achieve increased survival time, increased sensitivity, and enhanced therapeutic effect. Effect

Active Publication Date: 2020-09-04
ZHEJIANG UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, PGC-1α has been very little studied in leukemia and its role is still unclear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of pgc-1α-specific RNA interference adenovirus
  • Application of pgc-1α-specific RNA interference adenovirus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032]1. According to the mRNA sequence of the PGC-1α gene (NM_013261) provided by Genebank, a pair of primers were designed and synthesized using the RNAi design program of Invitrogen, USA, for the preparation of PGC-1a-specific shRNA. The primer sequences are as follows:

[0033] Upstream primers:

[0034] CCGGGACTATTGCCAGTCAATTAATCTCGAGATTAATTGACTGGCAATAGTCTTTTTG,

[0035] Downstream primers:

[0036] AATTCAAAAAGACTATTGCCAGTCAATTAATCTCGAGATTAATTGACTGGCAATAGTC.

[0037] After annealing to form double-stranded DNA (according to the conventional 50 μL annealing system, including 5 μL upstream primer, 5 μL downstream primer, 5 μL commercial 10x NEB buffer, 35 μL ddH 2 0; naturally cool to room temperature in boiling water bath for 5 minutes to complete the annealing), under the action of commercial T4DNA ligase (NEB), it is connected with the sticky end of the linearized shuttle vector pENTRTM / U6 (Addgene); the ligation product is transformed into Ecoli .DH5a competent cell...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses an application of PGC-1[alpha] specific RNA interfering adenovirus in reducing leukemia cell drug resistance. The PGC-1[alpha] specific RNA interfering adenovirus provided by the invention can enhance the sensitivity of acute myeloid leukemia cells to conventional chemotherapeutic drugs (an apoptotic cell proportion is increased from a range of 22.7-27.7% to a range from 40.3-50.5%), so that the survival time of a disease animal model can be obviously prolonged; taking a leukemia mouse model, which is prepared by virtue of OCI-AML3 cells, as an example, the average survival time of a leukemia mouse, under the circumstance of accepting conventional chemotherapy, is 37.9 days; and on the basis of the conventional chemotherapy, and in combination with PGC-1[alpha] specific RNA interfering adenovirus treatment, the average survival time of the mouse exceeds 45 days, which is prolonged by more than 20%.

Description

[0001] (1) Technical field [0002] The invention relates to the application of a PGC-1α-specific RNA interference adenovirus, in particular to the application in the preparation of medicines for treating acute myeloid leukemia. [0003] (2) Background technology [0004] The tumor microenvironment is the internal environment in which the tumor occurs and develops, and is composed of tumor cells themselves, interstitial cells, microvessels, interstitial fluid, and a small amount of infiltrating cells. The current research on tumor microenvironment and tumor malignant transformation mainly focuses on the following three aspects: (1) the bidirectional and dynamic relationship between tumor cells and their microenvironment; (2) how tumor cells interact with various types of cells in surrounding tissues Promote tumor invasion and metastasis; (3) How the tumor microenvironment mediates drug resistance of tumor cells. The above three aspects are both different and related. Looking b...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): A61K31/713A61K35/761A61P35/02C12N15/861
CPCA61K31/713A61K35/761C12N15/86C12N2710/10343
Inventor 陈烨孟文芳胡晓佳
Owner ZHEJIANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap