Novel kit for detecting genetic mutation
A mutant, kit-based technology, which can be used in the determination/inspection of microorganisms, DNA/RNA fragments, recombinant DNA technology, etc., and can solve problems such as low ctDNA content
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0087] The accuracy and sensitivity detection of embodiment 1 kit
[0088] The kit completely includes the detection of 11 sites, and the detection results are higher than that of QPCR technology. The data mainly includes four aspects: annealing temperature optimization, experimental background value, linear range and detection lower limit LOQ (Limit of quantification).
[0089] Among them, LOQ has two indicators, 1) the minimum detection sample value when the detection CV value is less than the theoretical CV value; 2) the minimum detection sample value when the detection CV value is less than 20%. The first type of indicator is used in the data aggregation.
[0090] Table 2 shows the probe sequences for detecting each mutation site, and Table 3 shows the primer sequences for amplifying the mutation sites.
[0091] Table 2
[0092]
[0093]
[0094] table 3
[0095]
[0096] Table 4 shows the LOD of the detection of the 11 mutation sites. The MCF7 background copy n...
Embodiment 2V392I
[0100] Embodiment 2V392I probe optimization
[0101] In the detection of mutation sites, the probes and primers used for each site were obtained through a large number of designs and screenings. Taking V392I as an example, the first set of primers and probe combinations were obtained through multiple optimization designs.
[0102] Primer sequences are as follows
[0103] Forward primer: ATGTGCCTGGCTAGAGATCC
[0104] Reverse primer: GCAAACAGTAGCTTCCCTGG
[0105] The probe sequence is
[0106] FAM: TTGGTCTCATCTGGCGCT
[0107] VIC: TTGGTCTCGTCTGGCGCT
[0108] The second set of optimized primer and probe sequences are as follows:
[0109] Primer sequences are as follows
[0110] Forward primer: AATGTGCCTGGCTAGAGATCC
[0111] Reverse primer: TAGGAGCAAACAGTAGCTTCCC
[0112] The probe sequence is
[0113] FAM: TTGGTCTCATCTGGC
[0114] VIC: TTGGTCTCGTCTGGC
[0115] After obtaining the optimal design, it was found through experiments that the optimal annealing temperature of...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com