Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Novel kit for detecting genetic mutation

A mutant, kit-based technology, which can be used in the determination/inspection of microorganisms, DNA/RNA fragments, recombinant DNA technology, etc., and can solve problems such as low ctDNA content

Inactive Publication Date: 2018-06-19
WUXI APPTEC ZK SUZHOU BIOSCIENCE CO LTD
View PDF14 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the extremely low levels of ctDNA in the blood, it is no longer detectable using conventional PCR methods

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel kit for detecting genetic mutation
  • Novel kit for detecting genetic mutation
  • Novel kit for detecting genetic mutation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0087] The accuracy and sensitivity detection of embodiment 1 kit

[0088] The kit completely includes the detection of 11 sites, and the detection results are higher than that of QPCR technology. The data mainly includes four aspects: annealing temperature optimization, experimental background value, linear range and detection lower limit LOQ (Limit of quantification).

[0089] Among them, LOQ has two indicators, 1) the minimum detection sample value when the detection CV value is less than the theoretical CV value; 2) the minimum detection sample value when the detection CV value is less than 20%. The first type of indicator is used in the data aggregation.

[0090] Table 2 shows the probe sequences for detecting each mutation site, and Table 3 shows the primer sequences for amplifying the mutation sites.

[0091] Table 2

[0092]

[0093]

[0094] table 3

[0095]

[0096] Table 4 shows the LOD of the detection of the 11 mutation sites. The MCF7 background copy n...

Embodiment 2V392I

[0100] Embodiment 2V392I probe optimization

[0101] In the detection of mutation sites, the probes and primers used for each site were obtained through a large number of designs and screenings. Taking V392I as an example, the first set of primers and probe combinations were obtained through multiple optimization designs.

[0102] Primer sequences are as follows

[0103] Forward primer: ATGTGCCTGGCTAGAGATCC

[0104] Reverse primer: GCAAACAGTAGCTTCCCTGG

[0105] The probe sequence is

[0106] FAM: TTGGTCTCATCTGGCGCT

[0107] VIC: TTGGTCTCGTCTGGCGCT

[0108] The second set of optimized primer and probe sequences are as follows:

[0109] Primer sequences are as follows

[0110] Forward primer: AATGTGCCTGGCTAGAGATCC

[0111] Reverse primer: TAGGAGCAAACAGTAGCTTCCC

[0112] The probe sequence is

[0113] FAM: TTGGTCTCATCTGGC

[0114] VIC: TTGGTCTCGTCTGGC

[0115] After obtaining the optimal design, it was found through experiments that the optimal annealing temperature of...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a novel kit for detecting genetic mutation. The kit comprises a) a mutation region probe provided with a first detection marker and b) a mutation region wild type probe providedwith a second detection marker, wherein the mutation region probe can be hybridized with a mutation sequence in a hotspot mutation region of a gene; the mutation region wild type probe can be hybridized with a wild type sequence in a mutation region of the gene. A first signal of the first detection marker and a second signal of the second detection marker are obtained by using the kit, copy number and mutation frequency of the mutant gene are calculated, and whether mutation exists in the hotspot mutation region of the gene is determined.

Description

technical field [0001] The invention relates to a kit for detecting gene mutations and a method thereof, in particular to detecting gene mutations in hot spot mutation regions of genes. Background technique [0002] The detection of mutated genes has important guiding significance for clinical medication and personalized treatment. About 70% of breast cancers are positive for the expression of estrogen receptor α (ER), and conventional treatment uses endocrine therapy. However, approximately 25% of patients with primary breast cancer and almost all patients with metastatic breast cancer have or eventually develop endocrine resistance. Treatment of endocrine-resistant patients with endocrine therapy such as tamoxifen or aromatase inhibitors is ineffective. Recent clinical experimental data show that activating mutations in the gene ESR1 (the gene encoding ER) are an important reason for endocrine resistance in breast cancer, and these mutations are concentrated in the ligan...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6886C12Q1/686C12N15/11
CPCC12Q1/6886C12Q1/686C12Q2600/156C12Q2563/159
Inventor 周瑜姜丽丽赵伟洁
Owner WUXI APPTEC ZK SUZHOU BIOSCIENCE CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products