Genetically engineered bacterium of co-expressed cyclohexanone monooxygenase and isopropanol dehydrogenase and application thereof

The technology of cyclohexanone monooxygenase and isopropanol dehydrogenase is applied in the fields of genetic engineering and fermentation engineering, can solve the problems of unsuitability for industrialized production, high cost, complicated operation procedures, etc., and achieves excellent industrial application value, Avoid fragmentation and centrifugation, reducing the effect of fermentation steps

Inactive Publication Date: 2018-07-03
ZHEJIANG JINGXIN PHARMA +1
View PDF4 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

US5840552A obtains a series of bacterial strains that can be used in biological oxidation reactions through screening to prepare merazole compounds. The catalytic chiral selectivity is good, and the ee value of the product is greater than 99%, but the disadvantage is that the product concentration is low, which is at the ppm level
CN 102884178A discloses a non-naturally occurring monooxygenase, which is used to catalyze the synthesis of prazoles. However, this method also requires the addition of cofactors and enzymes for the regeneration of the cofactors, although the product obtained by this method The concentration is relatively high, but because each enzyme needs to be fermented separately, the operation process is cumbersome, the cost is high, and the substrate concentration that can be catalyzed by a batch of reactions is relatively low (only 33g / L), so it is not suitable for industrial production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Genetically engineered bacterium of co-expressed cyclohexanone monooxygenase and isopropanol dehydrogenase and application thereof
  • Genetically engineered bacterium of co-expressed cyclohexanone monooxygenase and isopropanol dehydrogenase and application thereof
  • Genetically engineered bacterium of co-expressed cyclohexanone monooxygenase and isopropanol dehydrogenase and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1 Synthesis and Site-Directed Mutagenesis of Cyclohexanone Monooxygenase Gene Fragment

[0039] Query cyclohexanone-1,2-monooxygenase gene 1 (NCBI accession number is 578026767) through NCBI, synthesize the gene fragment, its nucleotide sequence is shown in SEQ ID NO.1, and the corresponding encoded amino acid sequence is shown in Shown in SEQ ID NO:2.

[0040] Protein engineering was performed on the cyclohexanone monooxygenase gene described above using the QuickChange Site-directed Mutagenesis (Stratagene) method (Agilent Technologies). Specifically, design the following primers F1 and R1 (corresponding to the corresponding mutation site at the underline), and fix the position of serine (Ser) at position 435 of the amino acid sequence SEQ ID NO:2 of the cyclohexanone monooxygenase gene Mutation transformation, mutating it to threonine (Thr):

[0041] Forward primer F1: GGTCCACTGGCCAAT AC TCCTCCTATCATCG (SEQ ID NO. 25)

[0042] Reverse primer R1: CGATGATA...

Embodiment 2

[0059] The synthesis of embodiment 2 isopropanol dehydrogenase gene fragments

[0060]Query isopropanol dehydrogenase gene 1 (NCBI accession number is 578026822) through NCBI, and synthesize the gene fragment, its nucleotide sequence is shown in SEQ ID NO.13, and the corresponding encoded amino acid sequence is shown in SEQ ID NO.14 Show.

[0061] Query the isopropanol dehydrogenase gene 2 (NCBI accession number is 938992178) through NCBI, synthesize the gene fragment, its nucleotide sequence is shown in SEQ ID NO.15, and the corresponding encoded amino acid sequence is shown in SEQ ID NO.16 Show.

[0062] Query the isopropanol dehydrogenase gene 3 (NCBI accession number is 931139619) through NCBI, synthesize the gene fragment, its nucleotide sequence is shown in SEQ ID NO.17, and the corresponding encoded amino acid sequence is shown in SEQ ID NO.18 Show.

[0063] Query isopropanol dehydrogenase gene 4 (NCBI accession number is 21225427) through NCBI, synthesize the gene f...

Embodiment 3

[0066] Embodiment 3 Construction of recombinant co-expression vector

[0067] With reference to "Molecular Cloning Experiment Guide" (third edition), edited by J. Sambrook, D.W. Russell (US), translated by Huang Peitang, etc., Science Press, Beijing, 2002), carry out the following enzyme digestion, connection or sensing Cell preparation and transformation experiments.

[0068] Forward primer F3: GGCCATATGAATAATTTTGTTTAACTTTAAGAAGGAGATATAATGAGTACCAAGATGGATTTTG (SEQ ID NO.29)

[0069] Reverse primer R3: CGCGGATCCTTACGCATTAGCCTGCTGTTTGG (SEQ ID NO.30)

[0070] Primers F3 and R3 were designed, and the nucleotide sequences of the three cyclohexanone monooxygenase gene fragments of SEQ ID NO.1, SEQ ID NO.3 and SEQ ID NO.5 were used as templates, respectively amplified by PCR Extend the cyclohexanone monooxygenase gene fragment (add Nde I and BamH I endonuclease fragments at both ends of the fragment); and insert these three genes into the pET 21a plasmid using Nde I and BamH I end...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses genetically engineered bacterium of co-expressed cyclohexanone monooxygenase and isopropanol dehydrogenase and application thereof. According to the invention, high-level co-expression of two enzymes is realized, enzyme fermentation process is simplified, and production cost is lowered. The genetically engineered bacterium constructed according to the method disclosed by the invention can catalyze and convert high-concentration ufiprazole into esomeprazole, and has an excellent industrial application value.

Description

technical field [0001] The invention belongs to the field of genetic engineering and fermentation engineering, and relates to a genetically engineered bacterium co-expressing cyclohexanone monooxygenase and isopropanol dehydrogenase and its application, in particular to a high-level co-expressing cyclohexanone monooxygenase Oxygenase and isopropanol dehydrogenase gene engineering bacteria, and its application in the preparation of chiral sulfoxide compounds, especially esomeprazole. Background technique [0002] Proton pump inhibitors (Proton pump inhibitors, PPIs) are a class of drugs widely used clinically for the treatment of gastric ulcers in recent decades. Traditional proton pump inhibitors are mainly chiral sulfoxide drugs, such as Esso Meprazole, L-pantoprazole and D-lansoprazole etc. Among them, esomeprazole is omeprazole in S configuration, and its chemical name is 5-methoxy-2-((S)-((4-methoxy-3,5-dimethyl-2 -pyridyl)methyl)sulfinyl)-1H-benzimidazole, CAS accessi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/21C12N15/70C12N9/02C12N9/04C12P17/16C12R1/19
CPCC12N9/0006C12N9/0073C12N15/70C12N2800/101C12P17/165C12Y101/0108C12Y114/13022
Inventor金圣芳张敏洁黄悦
OwnerZHEJIANG JINGXIN PHARMA