Unlock instant, AI-driven research and patent intelligence for your innovation.

BCR-ABL1 fusion gene e14a2 subtype plasmid candidate reference substance and preparation method and purpose thereof

A BCR-ABL1 and fusion gene technology, applied in the field of BCR-ABL1 fusion gene e14a2 subtype plasmid candidate reference materials, can solve the problem that there is no BCR-ABL1 fusion gene

Active Publication Date: 2018-07-10
AFFILIATED HOSPITAL OF NANTONG UNIV
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no candidate reference material for the e14a2 subtype plasmid of the BCR-ABL1 fusion gene in my country

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • BCR-ABL1 fusion gene e14a2 subtype plasmid candidate reference substance and preparation method and purpose thereof
  • BCR-ABL1 fusion gene e14a2 subtype plasmid candidate reference substance and preparation method and purpose thereof
  • BCR-ABL1 fusion gene e14a2 subtype plasmid candidate reference substance and preparation method and purpose thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0048] A plasmid candidate reference material of the e14a2 subtype of the BCR-ABL1 fusion gene, the nucleotide sequence of which is:

[0049] tgtcggagcaggagtcactgctgctgcttatgtctcccagcatggccttcagggtgcacagccgcaacggcaagagttacacgttcctgatctcctctgactatgagcgtgcagagtggagggagaacatccgggagcagcagaagaagtgtttcagaagcttctccctgacatccgtggagctgcagatgctgaccaactcgtgtgtgaaactccagactgtccacagcattccgctgaccatcaataaggaagatgatgagtctccggggctctatgggtttctgaatgtcatcgtccactcagccactggatttaagcagagttcaaaagcccttcagcggccagtagcatctgactttgagcctcagggtctgagtgaagccgctcgttggaactccaaggaaaaccttctcgctggacccagtgaaaatgaccccaaccttttcgttgcactgtatgattttgtggccagtggagataacactctaagcataactaaaggtgaaaagctccgggtcttaggctataatcacaatggggaatggtgtgaagcccaaaccaaaaatggccaaggctgggtcccaagcaactacatcacgccagtcaacagtctggagaaacactcctggtaccatgggcctgtgtcccgcaatgccgctgagtatctgctgagcagcgggatcaatggcagcttcttggtgcgtgagagtgagagcagtcctggccagaggtccatctcgctgagatacgaagggagggtgtaccattacaggatcaacactgcttctgatggcaagctctacgtctcctccgagagccgcttcaacaccctggccgagttggttcatc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a BCR-ABL1 fusion gene e14a2 subtype plasmid candidate reference substance and a preparation method and a purpose thereof. When the candidate reference substance is prepared, aprimer is designed, a molecule clone technology is employed for constructing a BCR-ABL1 fusion gene e14a2 subtype-containing recombinant plasmid candidate reference substance; through enzyme electrophoresis and sequencing verification, real-time fluorescence quantification PCR performs uniformity and stability evaluation, and the measurement uncertainty is determined. The uniform and stable BCR-ABL1 fusion gene e14a2 subtype plasmid candidate reference substance is prepared, can be used for calibration of a chronic granulocytic leukemia BCR-ABL1 fusion gene e14a2 subtype fluorescence quantification PCR related molecule diagnostic reagent manufacturer product, and can be used for evaluating the performance of a clinical laboratory real-time fluorescence quantification PCR detection method,so that the detection results of different clinical laboratories have comparability, and the clinical examination standardization can be promoted.

Description

technical field [0001] The invention relates to a BCR-ABL1 fusion gene e14a2 subtype plasmid candidate reference material and its preparation method and application. Background technique [0002] The characteristic molecular markers of chronic myeloid leukemia (CML) are composed of Abelson murine leukemia viral oncogene homolog1 (ABL1) and break point cluster region (break point cluster region, BCR-ABL1 fusion gene formed by BCR) translocation [1] . Various BCR-ABL1 subtypes are produced by different break sites in the BCR gene, the most common of which is the e14a2 subtype, which is formed by breaking the e14 exon of BCR and the a2 exon of ABL1 [2] . In recent years, the application of molecular biology techniques to target detection of BCR-ABL1 provides a basis for the diagnosis, therapeutic efficacy and dynamic monitoring of minimal residual lesions in CML. [0003] Real-time Quantitative Polymerase Chain Reaction (RQ-PCR) is a common method for detecting the fusion g...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6886C12Q1/6806C12Q1/6851C12N15/63
CPCC12N15/63C12Q1/6806C12Q1/6851C12Q1/6886C12Q2600/156C12Q2600/166C12Q2531/113C12Q2545/113
Inventor 景蓉蓉王惠民于书平崔明袁丹丹
Owner AFFILIATED HOSPITAL OF NANTONG UNIV