Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Identification method for types of descendant tree species of Liriodendron forest

An identification method and technology of Liriodendron tulipifera are applied in the field of identification of tree species types of Liriodendron tulipifera stand, which can solve the problems of not being able to fully meet the needs of use, insignificant differences in morphological characteristics, and being easily affected by environmental conditions, etc. , high efficiency and good stability

Active Publication Date: 2018-10-16
NANJING FORESTRY UNIV
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the difference in morphological characteristics is not obvious at the seedling stage and is easily affected by environmental conditions, and the dissection method is not easy to realize at the seedling stage, and the restriction of gene expression of isozyme markers will also affect the use. Fully meet the needs of use

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Identification method for types of descendant tree species of Liriodendron forest
  • Identification method for types of descendant tree species of Liriodendron forest
  • Identification method for types of descendant tree species of Liriodendron forest

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] A kind of identification method of tulip tree stand progeny tree type, concrete steps are as follows:

[0031] 1) The experimental materials in this example were collected from the provenance test forest of Liriodendron tulipiflora and its free-pollinated progeny in Longshan Forest Farm, Anji, Zhejiang. The ten mother trees in the forest test forest are five Chinese species (Z1, Z2, Z3, Z4, Z5) and five American species (B1, B2, B3, B4, B5), and the offspring each occupy a small plot of land. There is no strict block design, and the number of offspring in each plot is different, and they are collected one by one. When sampling, care should be taken to take the young leaves that have just unfolded on healthy plants, and after liquid nitrogen treatment, place them at -80°C until they are used in experiments.

[0032] 2) DNA extraction and detection

[0033] DNA extraction was carried out by CTAB method; DNA quality detection was analyzed by NANODROP instrument; PCR reac...

Embodiment 2

[0051] The special kit for the method of Example 1 includes at least a primer reagent used more than once. The primer reagent has a total of 1 pair of primers, and the amount used can be more than 25 times. The specific primer sequence is:

[0052] 119F:TACCATCCGTTAGTGCTTCCGCTCCTG;

[0053] 119R: CTTAGAATCGGGCATTCCACGCATCCA.

[0054] Preferably, the special kit includes DNA standard sample reagents for more than 25 detections, DNA extraction reagents for more than 25 detections, PCR reagents for more than 25 detections, and electrophoresis reagents for more than 25 detections; wherein,

[0055] The DNA standard contains at least 2 bands of 112bp and 124bp;

[0056] DNA extraction reagents: necessary reagents used in the CTAB method;

[0057] PCR reagents: conventional reagents for PCR amplification system;

[0058] Electrophoresis reagents: conventional electrophoresis reagents.

Embodiment 3

[0060] Use the special-purpose kit of embodiment 2 to carry out the identification method of hybrid Liriodendron stand progeny tree type, concrete steps are as follows:

[0061] 1) The experimental materials of this embodiment were collected from the Liriodendron tulipifera provenance test forest in Longshan Forest Farm, Anji, Zhejiang Province, without human intervention in the natural forest. A total of 107 samples were obtained by random sampling without repetition in the forest. When sampling, care should be taken to take the young leaves that have just unfolded on healthy plants, and after liquid nitrogen treatment, place them at -80°C until they are used in experiments.

[0062] 2) DNA extraction and detection

[0063] DNA extraction was carried out by CTAB method; DNA quality detection was analyzed and detected by NANODROP software; PCR reaction system used 10 μL system (75ng genomic DNA, 1.0μL 10×PCR Buffer, 1.2μL 2.5mM / L MgCl, 0.2μL 10mM / L dNTP , 0.5 μL 10 μM / L left...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an identification method for the types of descendant tree species of Liriodendron forest and a special kit thereof. The method comprises the following steps: 1) extracting leafDNA (Deoxyribonucleic Acid) of the descendant tree species; 2) performing SSR-PCR (Simple Sequence Repeat-Polymerase Chain Reaction) detection; 3) determining the descendant tree species, wherein thedescendant tree species which can specifically amplify a product of 112bp by electrophoresis are Liriodendron chinense (Hemsl.) Sarg., the descendant tree species which can specifically amplify a product of 124bp by electrophoresis are Liriodendron tulipifera Linn., and the descendant tree species which can specifically amplify products of 112bp and 124bp are hybrid of Liriodendron chinense and Liriodendron tulipifera. The identification method for the types of the descendant tree species of Liriodendron forests disclosed by the invention has the advantages of high repeatability and high stability, can effectively identify the types of descendant tree species of Liriodendron natural forests and artificial forests, particularly the descendant trees of Liriodendron natural forests and artificial forests at a seedling stage, and can identify whether seeds of seed orchards are Liriodendron chinense (Hemsl.). seeds, Liriodendron tulipifera seeds or seeds of hybrid of Liriodendron chinenseand Liriodendron tulipifera. The identification method has the advantages of fastness, high efficiency, accurate result and very high practicality.

Description

technical field [0001] The invention belongs to the technical field of tree species identification, and in particular relates to a method for identifying the type of tree species of the descendants of Liriodendron tulipifera stands. Background technique [0002] Liriodendron L. is a plant belonging to the family Magnoliaceae, which is one of the ancient genera. Now it includes three species: Liriodendron chinense (Hemsl.) Sarg., Liriodendron tulipifera Linn. and the hybrid Liriodendron chinense×tulipifera. Liriodendron is an ideal material for studying the evolutionary history of plants, and has important research significance. [0003] Liriodendron chinensis has a straight trunk and can be used as wood. It has three-lobed leaves in the shape of a mandarin jacket and has high ornamental value. It belongs to the national second-class rare and endangered protected plant. Liriodendron tulipifera is excellent in material, light yellowish brown, dense and beautiful in texture, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6895C12Q1/686
CPCC12Q1/686C12Q1/6895
Inventor 陈金慧龙晓飞肖保荣章文鑫王宇浩王鹏凯施季森胡凌峰杨立明
Owner NANJING FORESTRY UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com