Unlock instant, AI-driven research and patent intelligence for your innovation.

Preparation method of zebra fish notch3 gene mutant

A technology of t7-notch3-sfd and zebrafish, applied in biochemical equipment and methods, other methods of inserting foreign genetic materials, genetic engineering, etc., can solve the problem of low mutant ratio, achieve ingenious selection, stable inheritance, Effect of Convenience Study

Active Publication Date: 2018-11-06
SHANGHAI OCEAN UNIV
View PDF33 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0011] Although CRISPR-Cas9 knockout technology is widely used in model organisms such as mice, zebrafish, Drosophila, and Arabidopsis thaliana, the proportion of mutants with phenotype obtained after knockout of the whole gene of chromosome 1 in zebrafish using this technology is only Accounting for 5%, it can be seen that the proportion of mutants with obvious phenotypes is extremely low. The possible reasons are: 1) related to the selected target gene; 2) related to the selected target on the gene

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of zebra fish notch3 gene mutant
  • Preparation method of zebra fish notch3 gene mutant
  • Preparation method of zebra fish notch3 gene mutant

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0052] 1 Materials and equipment

[0053] 1.1 Experimental fish

[0054] The zebrafish used in this experiment were all AB strains, which were purchased from the Zebrafish Platform of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences.

[0055] 1.2 Plasmid

[0056] The pUC19-gRNA scaffold plasmid is derived from literature: Chang N, Sun C, Gao L, Zhu D, Xu X, ZhuX, Xiong JW, Xi JJ. Genome editing with RNA-guided Cas9 nuclease in zebrafishembryos, Cell Res, 2013, 23( 4): 465-472.

[0057] The pUC19-gRNA scaffold plasmid template sequence used in gRNA product synthesis is:

[0058] GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT (SEQ ID NO. 1).

[0059] 1.3 Main reagents

[0060] DNA Clean&Contentrator-5 (ZYMO RESEARCH, D4004), common DNA purification kit (TIANGEN, DP204-03), T7in vitro Transcription Kit (Ambion, AM1314), ethanol (absolute ethanol) (Sinopharm Chemical...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a preparation method of a zebra fish notch3 gene mutant. The method comprises steps as follows: a target position where a notch 3 gene is knocked out is determined; a pUC19-gRNA scaffold plasmid is taken as a template, and primers T7-notch3-sfd and tracr rev are used for PCR amplification; gRNA is obtained through purification and in-vitro transcription of a PCR product; gRNA and Cas9 protein are imported into a 1-cell stage of an embryo of zebra fish, culture is performed, and a stably inherited notch3 gene mutant is obtained. By use of a CRISPR / Cas9 technology, the notch3 gene in the zebra fish is knocked out by selecting a unique targeting zone without mistakenly damaging other genes, and the zebra fish with Notch3 knocked out is formed. Besides, the invention also discloses a phenotype of the notch3 gene deleted zebra fish mutant, which has great significance in research of Notch signal passages.

Description

technical field [0001] The invention relates to a zebrafish mutant, in particular to a method for preparing a zebrafish notch3 gene mutant. Background technique [0002] The CRISPR / Cas system was first discovered in the adaptive immune system of bacteria, and its main function is to fight against invading viruses and foreign DNA. In 1987, researchers at Osaka University discovered clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-related genes (CRISPR- associated genes, Cas gene), it is generally believed that 40% of bacterial genomes have such a structure. CRISPR technology is the latest third-generation genome editing tool, which can complete RNA-guided DNA recognition and editing. CRISPR / Cas9 gene editing technology originates from an acquired immune system of microorganisms to defend against the invasion of phage DNA or foreign plasmids. The defense mechanism of the CRISPR / Cas system can be divided into three stages. In the first stage, ca...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/90C12N15/113A01K67/027
CPCA01K67/0276A01K2217/075A01K2227/40C07K14/47C12N15/113C12N15/902C12N2310/20
Inventor 张庆华岳倩文季策徐行张秋月李伟明
Owner SHANGHAI OCEAN UNIV