Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Screening kit for metastatic screening of papillary thyroid microcarcinoma

A technology for papillary carcinoma and thyroid, which is applied in the determination/inspection of microorganisms, instruments, measuring devices, etc., can solve the problems of lack of transcriptomics, etc., and achieve the effect of avoiding over-treatment, rational use, and reducing psychological burden

Pending Publication Date: 2018-12-04
WEST CHINA HOSPITAL SICHUAN UNIV
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, there are no transcriptomic studies and literature reports related to papillary thyroid carcinoma (PTC) and papillary thyroid microcarcinoma (PTMC) (tumor diameter ≤ 1cm)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Screening kit for metastatic screening of papillary thyroid microcarcinoma

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Example 1 The relationship between the expression level of TESC and the status of papillary thyroid microcarcinoma

[0022] 1. Pathology Collection

[0023] Collected PTMC cases from December 2016 to May 2018 in West China Hospital of Sichuan University, and signed informed consent for specimen collection before operation. Those who met the above conditions were routinely collected surgically resected pathological tissue samples. Within 15 minutes after excising the glandular lobe where the cancer focus is located, the cancer focus and normal tissue are collected and filled with liquid nitrogen, and the patient’s information is registered in detail to make a record. After a few months, a pathological test is performed to determine whether there is high lymph node metastasis or no metastasis. Strictly select and include The expression level of TESC was detected in the tumor tissues of the non-metastasis and high-metastasis groups, 35 cases without metastases and 26 cases...

Embodiment 2

[0048] Embodiment 2 The present invention detects the composition of the kit of TESC and using method thereof

[0049] 1. PCR detection kit

[0050] 1. The composition of the kit

[0051] Detection kit (50 copies):

[0052] components

volume

upstream primer

0.5ul (10μM)

downstream primer

0.5ul (10μM)

2×PCR Enzyme Mix

10 μL

dd water

to a total volume of 20 μL

[0053] The primer sequences are as follows:

[0054] TESC: Forward: TCAACCCCATCCGATCCAAA

[0055] Reverse: ATCTCAGCTTCTCCTTCCGG

[0056] 2. How to use the kit

[0057] Take out the tumor tissue of the sample to be tested, place it on ice for 5 minutes to soften it, pulverize it with a tissue homogenizer, weigh it, and add 1ml TRIZOL per 100mg tissue. Add 0.2ml of chloroform to every 1ml of TRIZOL reagent lysed sample, and cap the tube tightly. Shake the tube vigorously by hand for 15 seconds, and incubate at 15 to 30°C for 2 to 3 minutes. Centrifuge at...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a screening kit for metastatic screening of papillary thyroid microcarcinoma and an application thereof. The kit can effectively determine whether an object is suffered from the metastatic papillary thyroid microcarcinoma or not, then the kit gives advice of early stage operation to a positive subject or allows continual observation to a negative subject. The kit avoids overtreatment and under-treatment of the papillary thyroid microcarcinoma and has excellent clinical application prospect.

Description

technical field [0001] The invention relates to a detection method for thyroid micropapillary carcinoma. Background technique [0002] The incidence of thyroid cancer is increasing rapidly around the world, and it is the solid malignant tumor with the fastest annual growth rate. It is estimated that by 2019, thyroid cancer will become the third most common malignant tumor in women. Most of these new cases are papillary thyroid microcarcinoma (PTMC), that is, papillary thyroid cancer with tumor diameter ≤1cm. Depending on the country, PTMCs account for between 40% and 50% of new thyroid cancers. At present, whether there is overdiagnosis and treatment of papillary thyroid microcarcinoma patients at home and abroad is one of the hottest and most controversial topics in thyroid surgery: Should PTMC patients choose early surgery or continue to observe? However, at present, there is no method at home and abroad to accurately judge the aggressiveness and prognosis of PTMCs befor...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6886G01N33/574
CPCC12Q1/6886C12Q2600/158G01N33/57407
Inventor 龚艳萍朱精强李志辉
Owner WEST CHINA HOSPITAL SICHUAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com