Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Detection method of invasive fungus infection, detection kit and application

A technology of invasive fungi and a detection method, applied in the field of detection kits, to achieve the effects of avoiding the possibility of contamination, saving manpower, and eliminating misdiagnosis

Active Publication Date: 2018-12-21
DIASYS DIAGNOSTIC SYST SHANGHAI
View PDF7 Cites 17 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Cell free DNA (cfDNA) detection is currently a hot spot in non-invasive in vitro diagnostics. It is mainly used in prenatal genetic screening and early diagnosis of genetic diseases such as tumors. There have been many methodological research reports, but So far, there is no report on the application of fungal cfDNA for detection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection method of invasive fungus infection, detection kit and application
  • Detection method of invasive fungus infection, detection kit and application
  • Detection method of invasive fungus infection, detection kit and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0107] Verify the method of the present invention with positive plasmid sample

[0108]In this example, the method of the present invention is used to carry out PCR detection on the plasmids of each positive bacterial species, and it is verified that the reaction system of the method of the present invention can be used to specifically identify Candida albicans, Candida tropicalis, and Candida smoothie at one time through multiple reactions in a single tube. Yeast or Candida krusei, Candida glabrata, Aspergillus fumigatus without cross-reaction. The positive plasmids of the above-mentioned bacterial species were included in each reaction, and the positive plasmids of each bacterial species were prepared individually or in combination into samples to be tested (plasmid concentration was 10 2 copies / μL).

Embodiment approach

[0110] 1. Prepare positive plasmids for strains

[0111] 1.1. Primer design: refer to the reported rDNA sequences of each strain (including 5.8s, 18s, 28s and ITS regions) to design and construct the primer sequences of the positive plasmids of each strain:

[0112] Candida albicans:

[0113] The 5'-3' sequence of the upstream primer: GGTGTTGAGCAATACGACTTGG (SEQ ID NO.15)

[0114] Downstream primer 5'-3' sequence: AGACCTAAGCCATTGTCAAAGC (SEQ ID NO.16)

[0115] Candida tropicalis:

[0116] Upstream primer 5'-3' sequence: TGGTATTCCAAAGGGCATGC (SEQ ID NO.17)

[0117] Downstream primer 5'-3' sequence: CCACGTTAAATTCTTTCAAAACAAA (SEQ ID NO.18)

[0118] Candida smoothie:

[0119] Upstream primer 5'-3' sequence: ATTGCGCCCTTAGGGCATG (SEQ ID NO.19)

[0120] Downstream primer 5'-3' sequence: TCCATTAGTTTATACTCCGCCTT (SEQ ID NO.20)

[0121] Candida krusei:

[0122] Upstream primer 5'-3' sequence: CTGTTTGAGCGTCGTTTCCA (SEQ ID NO.21)

[0123] Downstream primer 5'-3' sequence: TCCTAC...

Embodiment 2

[0149] Species identification testing using in vitro culture models infected with known species

[0150] In this example, the culture supernatant sample of in vitro simulation (PBMC) of certain fungal strains was used to test whether the PCR system of the present invention can use free fungal DNA to distinguish strains without being affected by non-detection target strains. Through this example, it is further confirmed that the kit of the present invention is suitable for distinguishing and identifying fungal species based on fungal free DNA fragments, and shows good system specificity and repeatability in the detection of in vitro simulated infection samples, without affected by other interfering factors.

[0151] 1. Implementation method:

[0152] 1. For the culture medium of known strains, take the supernatant after centrifugation, and extract DNA with Qiagen or Desay Diagnostic Systems (Shanghai) Co., Ltd. Blood DNA Extraction Kit.

[0153] 2. The real-time PCR reaction ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a fast multiplex PCR identification diagnosis detection method of invasive fungus infection based on cfDNA (cell free DNA). The method can be used for identifying the invasive infection caused by clinic common and high-incidence Candida albicans, Candida tropicalis, Candida parapsilosis, Candida krusei, Candida glabrata and Aspergillus fumigtus. An amplification primer is designed according to characteristic genome segments of each fungus category and species; a detection fluorescence probe of a strain can be distinguished according to the amplification segment design; the real time PCR can be performed on a sample to be tested; high sensitivity of nested PCR and high specificity and multi-target performance advantages of multiple fluorescent hybrid probe PCR are integrated for identifying the fungus strain. The invention also provides a PCR diagnosis kit for the invasive fungus infection and application thereof.

Description

technical field [0001] The invention belongs to the technical field of biomedical detection, and relates to a rapid detection method for invasive fungal infection, in particular to a method for identifying invasive infections caused by clinically common and high-incidence fungi based on fungal free DNA (cfDNA) by using multiplex PCR technology Diagnostic methods and applications, and detection kits. Background technique [0002] In recent years, with the acceleration of population aging, the increase in the incidence of diseases such as tumors and immunodeficiency, the rapid development of solid organ and hematopoietic stem cell transplantation, and the large-scale use of antibiotics and immunosuppressants, the incidence of invasive fungal diseases has increased year by year. However, the current diagnostic methods are limited, and early and accurate diagnosis is not possible, which easily delays the best time for treatment, resulting in poor clinical prognosis and high mort...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6848C12Q1/6895C12Q1/04C12N15/11
CPCC12Q1/6848C12Q1/6895C12Q2537/143C12Q2549/119C12Q2563/107
Inventor 王荣芳陈昊钱震斌
Owner DIASYS DIAGNOSTIC SYST SHANGHAI
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More