Prognosis marker for lung cancer and application thereof
A prognostic marker and marker technology, applied in the field of biomedicine, can solve the problems of tumor cell invasion, lack of treatment measures, metastasis, etc., and achieve the effects of improving molecular diagnosis of prognosis, saving medical costs, and high clinical application value
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0039] The present invention will be further described below in conjunction with specific examples, but is not limited thereto.
[0040] The Ensembl ID of the long non-coding RNA gene RP11-434D9.1 is ENSG00000249364, and its cDNA sequence is shown in SEQ ID NO: 1:
[0041] CCCAGTGTGAAGTGAAAGCAAAGTTTTAAAATTTTTTCTCCTCTGCAAGAAAATATATTTCAGAAAATCTCTATCTCAAAAATGAAGCAATTAAGAACTGTCTGGCTGTGAGGATCTGGCCTCAACTTGACTTAAAGCAACAACTTCAGTTACATATCAAGATGTGCGTGAGAATGAACCTGCTCTGCTCAGCCAACGTGCTGAGTGACTTGATGTTTGTAATAAATAAATAAATAAACAACAAACAGGTTGTCATGAAATATCCTTTGTAATTATAAACACAGGAAACTTTCTGAGATGCAAGTGGGTGTTAAATGGTTCAGCAAAGCCAAGCCAGAGCAGTTGGTGTGCTTTGAAATGAAGCAACATTGGAAAAATGAAATCTACTGAAAGATCACTACGTGTTTCAAAGAACTGACTAGAACCAGAACTCTTCAGAAAAGAATGTGCTAAAGGTTTGTCCTTGAGAAGTTTCCAAGCCAAGACACTCCTAGGAGCACTTCCCATTGAGGCCGAAAGGCTCATCCACTTACAGCGATTCATGGGAAAAGAGGACAGCACCCTCATCTTTGGTCCAAGAACACAATCCTGAGTGACACAGGATTGCCCTGAAAGTCAACAGCATCCGTCTTACAAAAATCAACAACACTCGCTTTTCAAACTTCCAAAGAATTTACTGGTCTGGTTTGGCCTTTTGGTGCCACATTCCATTCCAGAAC...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap