Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of TLR7 and TLR8 as prophylactic and therapeutic targets for IgA nephropathy and inhibitors of TLR7 and their use

A technology of therapeutic targets and inhibitors, applied in the field of biomedicine, can solve the problems of unclear expression level and mechanism of action, achieve strong clinical application value, and alleviate the effect of O-glycosylation

Inactive Publication Date: 2019-01-25
THE FIRST AFFILIATED HOSPITAL OF SUN YAT SEN UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] At present, the expression level and mechanism of TLR7 and TLR8 genes in IgA nephropathy patients are not clear, and the regulation of IgA1 synthesis and abnormal O-glycosylation by TLR7 and TLR8 in IgA nephropathy has not been reported yet.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of TLR7 and TLR8 as prophylactic and therapeutic targets for IgA nephropathy and inhibitors of TLR7 and their use
  • Application of TLR7 and TLR8 as prophylactic and therapeutic targets for IgA nephropathy and inhibitors of TLR7 and their use
  • Application of TLR7 and TLR8 as prophylactic and therapeutic targets for IgA nephropathy and inhibitors of TLR7 and their use

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] The application of TLR7 and TLR8 as therapeutic targets for IgA nephropathy is provided.

[0033] Wherein, the upstream primer of human TLR7 gene detection is: 5'GATGCCTTCCAGTTGCGATA

[0034] Wherein, the upstream primer for human TLR8 gene detection is: 5'CTCATGCAGAGCATCAACCA3'; the downstream primer for human TLR8 gene detection is 5'ACACTGGCTCCAGCAGGATA 3'.

Embodiment 2

[0036] Provides an inhibitor of TLR7 having the formula C 16 h 19 N 3 o 2 , and have formula I to represent chemical structure:

[0037]

[0038] Wherein, the Chinese name of the formula I is 1-(2(diethylamino)ethyl)chromo[3,4-D]imidazol-4(1H)-one.

[0039] Wherein, the English name of formula I is 1-(2-(diethylamino)ethyl)chromeno[3,4-d]imidazol-4(1H)-one.

Embodiment 3

[0041] The invention provides the application of the inhibitor of TLR7 in the preparation of medicines for treating and preventing IgA nephropathy.

[0042] Use of an inhibitor of TLR7 for inhibiting human IgA1 synthesis is provided.

[0043] Provides the application of TLR7 inhibitors in alleviating abnormal O-glycosylation of human IgA1 molecules.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of biomedical technology, in particular to the application of TLR7 and TLR8 as prophylactic and therapeutic targets of IgA nephropathy and the applicationof inhibitor of TLR7 in prophylactic and therapeutic treatment of IgA nephropathy. The invention proves that the expression level of TLR7 gene and TLR8 gene in peripheral blood mononuclear cells (PBMCs) of IgA nephropathy patients is significantly increased compared with healthy control and disease control, when activated by TLR7 and TLR8 co-ligand R848, more IgA1 antibodies were produced, and abnormal O-glycosylation of the IgA1 antibodies were aggravated. Compounds of formula C<16>H<19>N<3>O<2> act as inhibitors of TLR7, inhibiting the ability of peripheral mononuclear blood cells to synthesize IgA1 and decreasing the abnormal O-glycosylation of these IgA1 molecules. Glycosylation. TLR7 and TLR8 are novel targets for the treatment of IgA nephropathy and have great clinical value.

Description

technical field [0001] The invention relates to the technical field of biomedicine, in particular to the application of Toll-like receptor 7 (TLR7) and Toll-like receptor 8TLR8 as targets for the prevention and treatment of IgA nephropathy and the application of TLR7 inhibitors in the prevention and treatment of IgA nephropathy. Background technique [0002] IgA nephropathy (IgAN) is the most common primary glomerular nephropathy worldwide, especially in the Asia-Pacific region. It is reported that IgA nephropathy accounts for 45.3% of primary glomerular diseases in my country. Long-term follow-up studies have shown that 25% to 30% of IgA nephropathy patients progress to end-stage renal failure (uremia) within 20 to 25 years after onset, which has brought serious impact and heavy economic burden on the country, society and patients' families . Therefore, it is of great clinical significance to explore target therapeutic molecules for IgA nephropathy and develop related ther...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6883C07D491/052A61P13/12
CPCA61P13/12C12Q1/6883C07D491/052C12Q2600/158
Inventor 余学清郑诺燕范瑾瑾
Owner THE FIRST AFFILIATED HOSPITAL OF SUN YAT SEN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com