Application of TLR7 and TLR8 as prophylactic and therapeutic targets for IgA nephropathy and inhibitors of TLR7 and their use
A technology of therapeutic targets and inhibitors, applied in the field of biomedicine, can solve the problems of unclear expression level and mechanism of action, achieve strong clinical application value, and alleviate the effect of O-glycosylation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] The application of TLR7 and TLR8 as therapeutic targets for IgA nephropathy is provided.
[0033] Wherein, the upstream primer of human TLR7 gene detection is: 5'GATGCCTTCCAGTTGCGATA
[0034] Wherein, the upstream primer for human TLR8 gene detection is: 5'CTCATGCAGAGCATCAACCA3'; the downstream primer for human TLR8 gene detection is 5'ACACTGGCTCCAGCAGGATA 3'.
Embodiment 2
[0036] Provides an inhibitor of TLR7 having the formula C 16 h 19 N 3 o 2 , and have formula I to represent chemical structure:
[0037]
[0038] Wherein, the Chinese name of the formula I is 1-(2(diethylamino)ethyl)chromo[3,4-D]imidazol-4(1H)-one.
[0039] Wherein, the English name of formula I is 1-(2-(diethylamino)ethyl)chromeno[3,4-d]imidazol-4(1H)-one.
Embodiment 3
[0041] The invention provides the application of the inhibitor of TLR7 in the preparation of medicines for treating and preventing IgA nephropathy.
[0042] Use of an inhibitor of TLR7 for inhibiting human IgA1 synthesis is provided.
[0043] Provides the application of TLR7 inhibitors in alleviating abnormal O-glycosylation of human IgA1 molecules.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


