Check patentability & draft patents in minutes with Patsnap Eureka AI!

A method for full-sequence primer design and phylogenetic analysis of the complete mitochondrial genome of the multi-scaled mullet goby

A technology for mitochondrial genome, polysquamous mullet goby, applied in sequence analysis, biochemical equipment and methods, bioinformatics, etc., to achieve the effect of saving reagent costs

Active Publication Date: 2022-03-25
ZHEJIANG OCEAN UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] In order to solve the above-mentioned problem of not being able to amplify the full mitochondrial genome sequence of the multi-scaled mullet goby at present, a method is provided that can amplify its mitochondrial genome at one time and quickly obtain its full genome sequence through sequencing and splicing. It is simple, Fast and efficient full-sequence amplification method for the complete mitochondrial genome of the mullet mullet goby and its design and phylogenetic analysis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for full-sequence primer design and phylogenetic analysis of the complete mitochondrial genome of the multi-scaled mullet goby
  • A method for full-sequence primer design and phylogenetic analysis of the complete mitochondrial genome of the multi-scaled mullet goby
  • A method for full-sequence primer design and phylogenetic analysis of the complete mitochondrial genome of the multi-scaled mullet goby

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0069] 1. Primer Design

[0070] The complete mitochondrial genome sequence of the Gobialidae was downloaded from the Genbank database. Through multiple alignment of these sequences, the relatively conserved regions and regions with large variations were found, and 12 pairs of universal primers were designed in the relatively conserved regions.

[0071] in

[0072] First pair of primers:

[0073] Forward primer 1 is shown in SEQ ID NO.1: 5'- TAAAGCATAACHCTGAAGATGTTAA - 3'

[0074] Reverse primer 1 is shown in SEQ ID NO.2: 5'- GATAGAAACTGACCTGGATTACT - 3'

[0075] Second pair of primers:

[0076] Forward primer 1 is shown in SEQ ID NO.3: 5'- AACHCTGAAGATGTTAAGAT - 3'

[0077] Reverse primer 1 is shown in SEQ ID NO.4: 5'- TAAGAATGCAACAGCTAGCAGA - 3'

[0078] The third pair of primers:

[0079] Forward primer 1 is shown in SEQ ID NO.5: 5'- TACGACCTCGATGTTGGATCAGG - 3'

[0080] Reverse primer 1 is shown in SEQ ID NO.6: 5'-GCGGTGGATTGTAGACCCCATARACAGAGGT-3'

[0081] The fou...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
body lengthaaaaaaaaaa
Login to View More

Abstract

The present invention relates to the field of molecular biology technology, in particular to a primer for the full sequence of the mitochondrial genome of the mullet goby and a method for designing and amplifying the full sequence of the phylogenetic analysis, including twelve pairs of primers as shown in SEQ ID NO.1-24 . The present invention solves the problem that the complete mitochondrial genome sequence of the multiscaled mullet goby cannot be amplified at present, and has (1) its mitochondrial genome can be amplified at one time, and its complete genome sequence can be quickly obtained through sequencing splicing, which is convenient and efficient Advantages; (2) Provide a primer for the complete mitochondrial genome sequence of the multiscale mullet goby, which saves time and effort, and saves reagent costs; (3) The provided systematic analysis method for the full sequence primer of the multiscale mullet goby mitochondrial genome is multiscale The population genetics, germplasm resource protection and sustainable development and utilization of mullet gobies, and the phylogenetic research of gobies provide important molecular methods and data accumulation.

Description

technical field [0001] The invention relates to the technical field of molecular biology, in particular to a primer for the full sequence of the mitochondrial genome of the mullet goby and a method for designing and phylogenetic analysis of the full sequence amplification. Background technique [0002] Goby family, Gobiidae (G. Cuvier, 1816), a family of bony fishes of the order Perciformes, and also the largest family of marine fishes, commonly known as gobies. There are more than 1,480 species in 196 genera, and more than 120 species in 40 genera are produced in China. The body length is generally 100-150 mm, the largest is no more than 500 mm, and the smallest is only 7-9 mm. [0003] Body oval, elongate or eel-shaped, laterally flattened. Flattened or flattened sides of the head. The eyes do not protrude from the back of the head, and there is no free lower eyelid. Mouth large, two jaws equal in length or protruding mandible and chin. The upper and lower teeth are ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6888C12N15/11C12N15/10G16B30/10
CPCC12N15/10C12Q1/6888C12Q2600/124
Inventor 龚理姜辉刘炳舰吕振明刘立芹
Owner ZHEJIANG OCEAN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More