A method for full-sequence primer design and phylogenetic analysis of the complete mitochondrial genome of the multi-scaled mullet goby
A technology for mitochondrial genome, polysquamous mullet goby, applied in sequence analysis, biochemical equipment and methods, bioinformatics, etc., to achieve the effect of saving reagent costs
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0069] 1. Primer Design
[0070] The complete mitochondrial genome sequence of the Gobialidae was downloaded from the Genbank database. Through multiple alignment of these sequences, the relatively conserved regions and regions with large variations were found, and 12 pairs of universal primers were designed in the relatively conserved regions.
[0071] in
[0072] First pair of primers:
[0073] Forward primer 1 is shown in SEQ ID NO.1: 5'- TAAAGCATAACHCTGAAGATGTTAA - 3'
[0074] Reverse primer 1 is shown in SEQ ID NO.2: 5'- GATAGAAACTGACCTGGATTACT - 3'
[0075] Second pair of primers:
[0076] Forward primer 1 is shown in SEQ ID NO.3: 5'- AACHCTGAAGATGTTAAGAT - 3'
[0077] Reverse primer 1 is shown in SEQ ID NO.4: 5'- TAAGAATGCAACAGCTAGCAGA - 3'
[0078] The third pair of primers:
[0079] Forward primer 1 is shown in SEQ ID NO.5: 5'- TACGACCTCGATGTTGGATCAGG - 3'
[0080] Reverse primer 1 is shown in SEQ ID NO.6: 5'-GCGGTGGATTGTAGACCCCATARACAGAGGT-3'
[0081] The fou...
PUM
| Property | Measurement | Unit |
|---|---|---|
| body length | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



