A kind of tobacco chloride ion absorption gene ntslac2 and its cloning method and application

A chloride ion and tobacco technology, applied in the field of genetic engineering, has achieved broad application prospects, reduced chloride ion content, and huge potential for economic benefits

Active Publication Date: 2021-12-24
YUNNAN ACAD OF TOBACCO AGRI SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, because the SLAC gene is a gene family, there will be the possibility of gene differentiation, and at the same time there are large differences between the genes in Nicotiana benthamiana and the cultivated tobacco, so the endogenous SLAC gene in the cultivated tobacco is directly verified by means of RNAi interference. Function key to identifying genes responsible for chloride uptake in cultivated tobacco

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of tobacco chloride ion absorption gene ntslac2 and its cloning method and application
  • A kind of tobacco chloride ion absorption gene ntslac2 and its cloning method and application
  • A kind of tobacco chloride ion absorption gene ntslac2 and its cloning method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Cloning of the NtSLAC2 gene

[0038] Tobacco leaf cDNA was used as a template, primers were designed according to the tobacco genome database information, and PCR amplification of the NtSLAC2 gene was carried out to obtain PCR amplification products. The designed primers were as follows:

[0039] Forward primer: 5'- ATGAGAATCACTCCTGCATTAGATG -3';

[0040] Reverse primer: 5'- TCAAATAATTCGAGAAGACTGTTTG -3';

[0041] The PCR reaction system and amplification conditions are as follows:

[0042]

[0043] The amplified PCR product was electrophoresed on a 0.8% agarose gel, and the gel electrophoresis results were as follows: figure 1 As shown, after electrophoresis, the PCR product purification kit from Qiagen was used to recover and purify the PCR product according to the product instructions, and sent to Invitrogen for sequencing to verify the sequence results.

Embodiment 2

[0045] Construction of Plant RNAi Vectors

[0046] Using the full-length fragment of NtSLAC2 in Example 1 as a template, PCR amplification was performed with primers containing the gateway linker sequence. After purification of the PCR product, the amplified product was inserted into the pdonr-zeo vector of Invitrogen Company through BP reaction (see figure 2 ), the constructed BP reaction vector was used to replace the NtSLAC2 fragment into the PHellsgate12 RNAi interference vector by LR reaction (see image 3 )middle.

[0047] (1) The gateway reaction primer sequence is as follows:

[0048] NtSLAC2 _F

[0049] 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTGCTTTACTAAGGGGAAGAGACTTTTAACA-3';

[0050]NtSLAC2 _R

[0051] 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTCCCTGATAATCTCTGATATAACGTCACAA-3'.

[0052] (2) PCR reactions were performed using Phusion high-fidelity polymerase for PCR cloning.

[0053] The PCR reaction system and conditions were the same as in Example 1.

[0054] (3) BP response:...

Embodiment 3

[0071] Agrobacterium-mediated transformation of tobacco and identification of transgenic plants

[0072] (1) Transformation of Agrobacterium by freeze-thaw method

[0073] Add 1 μg (200 ng / μL) pHellsgate12 RNAi recombinant vector to 100 μL competent Agrobacterium LBA4404, mix well, let stand on ice water for 5 minutes, freeze in liquid nitrogen for 5 minutes, and then remove from liquid nitrogen , placed in a 37°C water bath for 5 minutes, and then placed on ice for 5 minutes, then added 500 μL LB solution, resumed cultivation at 28°C for 4 hours under sufficient shaking conditions, and finally spread the bacterial solution evenly on the selective cultured on plate medium for 48 h at 28°C.

[0074] (2) Tobacco variety Yunyan 87 was transformed by leaf disc method.

[0075] The specific method is as follows:

[0076] (a) Under aseptic conditions, put the tobacco Yunyan 87 seeds into the EP tube and rinse them with sterile water for 2-3 times;

[0077] (b) Soak in 75% alcoho...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a tobacco chloride ion absorbing gene NtSLAC2 and its cloning method and application. The nucleotide sequence of the tobacco chloride ion absorbing gene NtSLAC2 is shown in SEQ ID: No.1, and the encoded amino acid sequence is shown in SEQ ID: No.2. shown. The invention also discloses a method for cloning tobacco chloride ion absorbing gene NtSLAC2. The specific steps include: extracting tobacco RNA, and reverse-transcribing to obtain the first-strand cDNA; Synthesize specific primers, perform PCR amplification, recover and purify the PCR amplification products, and sequence them. In the present invention, suppress tobacco endogenous gene in tobacco plant NtSLAC2 The expression of can significantly reduce the chloride ion content of tobacco leaves, and has broad application prospects in the field of plant breeding with low chloride ion content, and its economic benefit potential is huge.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a cloning method and application of tobacco chloride ion absorption gene NtSLAC2. Background technique [0002] Chloride ion content is an important quality parameter in tobacco. The chloride ion content in tobacco leaves is 0.3~0.8 as appropriate. If the chloride ion content in tobacco leaves is too high, it will affect the combustibility of cigarette products and cause smoldering of cigarette products, thus There will be more carbon monoxide and tar in the smoke of cigarette products, which will endanger the health of consumers. And when the content of chloride ions is higher, it will directly cause the phenomenon of flameout. [0003] At present, when growing vegetables and food crops in our country, a large amount of chemical fertilizers and pesticides are used. The current chemical fertilizers contain a large amount of chloride ions, and these chemic...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/29C07K14/415C12N15/10C12N15/82A01H5/00A01H6/82
CPCC12N15/8261C07K14/415
Inventor 白戈谢贺逄涛杨大海李勇姚恒童治军张谊寒肖炳光李永平
Owner YUNNAN ACAD OF TOBACCO AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap