A kind of tobacco chloride ion absorption gene ntslac2 and its cloning method and application
A chloride ion and tobacco technology, applied in the field of genetic engineering, has achieved broad application prospects, reduced chloride ion content, and huge potential for economic benefits
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] Cloning of the NtSLAC2 gene
[0038] Tobacco leaf cDNA was used as a template, primers were designed according to the tobacco genome database information, and PCR amplification of the NtSLAC2 gene was carried out to obtain PCR amplification products. The designed primers were as follows:
[0039] Forward primer: 5'- ATGAGAATCACTCCTGCATTAGATG -3';
[0040] Reverse primer: 5'- TCAAATAATTCGAGAAGACTGTTTG -3';
[0041] The PCR reaction system and amplification conditions are as follows:
[0042]
[0043] The amplified PCR product was electrophoresed on a 0.8% agarose gel, and the gel electrophoresis results were as follows: figure 1 As shown, after electrophoresis, the PCR product purification kit from Qiagen was used to recover and purify the PCR product according to the product instructions, and sent to Invitrogen for sequencing to verify the sequence results.
Embodiment 2
[0045] Construction of Plant RNAi Vectors
[0046] Using the full-length fragment of NtSLAC2 in Example 1 as a template, PCR amplification was performed with primers containing the gateway linker sequence. After purification of the PCR product, the amplified product was inserted into the pdonr-zeo vector of Invitrogen Company through BP reaction (see figure 2 ), the constructed BP reaction vector was used to replace the NtSLAC2 fragment into the PHellsgate12 RNAi interference vector by LR reaction (see image 3 )middle.
[0047] (1) The gateway reaction primer sequence is as follows:
[0048] NtSLAC2 _F
[0049] 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTGCTTTACTAAGGGGAAGAGACTTTTAACA-3';
[0050]NtSLAC2 _R
[0051] 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTCCCTGATAATCTCTGATATAACGTCACAA-3'.
[0052] (2) PCR reactions were performed using Phusion high-fidelity polymerase for PCR cloning.
[0053] The PCR reaction system and conditions were the same as in Example 1.
[0054] (3) BP response:...
Embodiment 3
[0071] Agrobacterium-mediated transformation of tobacco and identification of transgenic plants
[0072] (1) Transformation of Agrobacterium by freeze-thaw method
[0073] Add 1 μg (200 ng / μL) pHellsgate12 RNAi recombinant vector to 100 μL competent Agrobacterium LBA4404, mix well, let stand on ice water for 5 minutes, freeze in liquid nitrogen for 5 minutes, and then remove from liquid nitrogen , placed in a 37°C water bath for 5 minutes, and then placed on ice for 5 minutes, then added 500 μL LB solution, resumed cultivation at 28°C for 4 hours under sufficient shaking conditions, and finally spread the bacterial solution evenly on the selective cultured on plate medium for 48 h at 28°C.
[0074] (2) Tobacco variety Yunyan 87 was transformed by leaf disc method.
[0075] The specific method is as follows:
[0076] (a) Under aseptic conditions, put the tobacco Yunyan 87 seeds into the EP tube and rinse them with sterile water for 2-3 times;
[0077] (b) Soak in 75% alcoho...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



