A Molecular Marker Related to Sheep Feed Conversion Rate and Its Application

A feed conversion rate and molecular marker technology, applied in the field of molecular marker preparation, can solve the problems of unclear genetic mechanism of sheep feed conversion rate and candidate genes that have not been reported yet, and achieve great practical application value, low-cost operation method, and cost reduction Effect

A feed conversion rate and molecular marker technology, applied in the field of molecular marker preparation, can solve the problems of unclear genetic mechanism of sheep feed conversion rate and candidate genes that have not been reported yet, and achieve great practical application value, low-cost operation method, and cost reduction Effect

CN109694916BActive Publication Date: 2022-03-25GANSU AGRI UNIV

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A Molecular Marker Related to Sheep Feed Conversion Rate and Its Application
  • A Molecular Marker Related to Sheep Feed Conversion Rate and Its Application
  • A Molecular Marker Related to Sheep Feed Conversion Rate and Its Application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1 Amplification of the PPARGC1B gene

[0037] (1) Primer design

[0038] Using sheep PPARGC1B gene DNA (GenBank accession number: NC_019462.2) as a template, a pair of primers M-F and M-R were designed using Primer5.0 software. The primer sequences are as follows

[0039] PPARGC1B:

[0040] M-F: 5'-ACCCATCAACGCTGCGAAAG-3' (SEQ ID NO: 2),

[0041] M-R: 5'-GCCAATGAGCCACCCTACAC-3' (SEQ ID NO: 3).

[0042] (2) Amplification and sequencing of PPARGC1B gene

[0043] The total volume of the PCR reaction is 25 μL, including 1 μL of DNA template, 12.5 μL of 2×PCR Master Mix, 0.8 μL of upstream primer, 0.8 μL of downstream primer, ddH 2 O 9.9 μL. The PCR amplification program was: pre-denaturation at 94°C for 3 min, denaturation at 94°C for 30 s, annealing at 54.5°C for 30 s, extension at 72°C for 30 s, 35 cycles, and finally extension at 72°C for 10 min. The PCR reaction product was detected by 1.5% agarose gel electrophoresis, and the results showed that a 337bp s...

Embodiment 2

[0046] The establishment of embodiment 2 genotyping detection method

[0047] (1) Primer sequence design

[0048] A pair of KASPar primers are designed for the G / A polymorphic site of the amplified fragment in Example 1, so as to be used for the specific detection of the polymorphic site, and the nucleotide sequence of the KASPar primer pair is:

[0049] Forward primer A1 for detection of AlleleA:

[0050] GAAGGTGACCAAGTTCATGCTTTCTAGAAATTGCTGACTTATTATTCCATA (SEQ ID NO: 4);

[0051] Forward primer A2 for detection of AlleleG:

[0052] GAAGGTCGGAGTCAACGGATTCTAGAAATTGCTGACTTATTATTCCATG (SEQ ID NO: 5);

[0053] Universal reverse primer C: CAATGAGCCACCCTACACCCAAC (SEQ ID NO: 6).

[0054] The above primers were synthesized by entrusting Beijing Sangong Bioengineering Co., Ltd., and the primers of each group in the KASPar primer pair were diluted to 10 μmol / L, and mixed according to the volume ratio of 12:12:30 (primer A1: primer A2: primer C) Evenly reserve.

[0055] (2) DNA q...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a molecular marker related to sheep feed conversion rate, as well as a detection method and application of the molecular marker. In the present invention, through PCR amplification and sequence analysis of the sheep PPARGC1B gene, it is found that there is a G / A polymorphic site in the 300th position of the amplified fragment, and the polymorphic site of 172 Hu sheep is further used KASPar primers After detection and establishment of least squares model, correlation analysis between genotype and feed conversion rate was carried out, and finally it was determined that the amplified PPARGC1B gene fragment of the present invention can be used as a molecular marker related to sheep feed conversion rate. The molecular marker of the invention can be used for the selection of grain-saving sheep and the cultivation of new breeds of grain-saving high-quality mutton sheep, and provides genetic engineering means for the genetic improvement of sheep feed conversion rate, and has great practical application value.

Description

technical field [0001] The invention belongs to the technical field of molecular marker preparation, and specifically relates to a PPARGC1B gene fragment as a molecular marker affecting the feed conversion rate of sheep and its application. Background technique [0002] With the development of the economy, people have an increasing demand for the quantity and types of meat, among which mutton is one of the ingredients with a relatively large demand. According to statistics, there are currently about 300 million sheep and goats in the country (Zhao Youzhang. The development trend, problems and countermeasures of the sheep industry at home and abroad. Modern Animal Husbandry and Veterinary Medicine, 2015, (09): 63-68). my country has a large population and limited pastures. Most of the sheep are fed under the conditions of barn feeding and are highly dependent on food. How to alleviate the contradiction between humans and animals competing for food to the greatest extent and im...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
25 Mar 2022
Publication
CN109694916B
IPC
C12Q1/6888; C12N15/11
CPC
C12Q1/6888; C12Q2600/156; C12Q2600/124
Inventors
王维民; 张德印