RYR2 (ryanodine receptor 2) gene as molecular marker to affect feed conversion rate of sheep and application of molecular marker

A feed conversion rate and molecular marker technology, applied in the field of molecular marker preparation, can solve the problems of less research and achieve the effects of low-cost operation method, retention accuracy and cost reduction

Active Publication Date: 2019-06-21
GANSU AGRI UNIV
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Current research on this gene is mainly focused on human medicine, but so far, relatively little research has been done on sheep

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • RYR2 (ryanodine receptor 2) gene as molecular marker to affect feed conversion rate of sheep and application of molecular marker
  • RYR2 (ryanodine receptor 2) gene as molecular marker to affect feed conversion rate of sheep and application of molecular marker
  • RYR2 (ryanodine receptor 2) gene as molecular marker to affect feed conversion rate of sheep and application of molecular marker

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Embodiment 1 Amplification of RYR2 gene

[0037] (1) Primer design

[0038] Using the sheep RYR2 gene DNA (GenBank accession number: NC_040276.1) as a template, a pair of primers M-F and M-R were designed using Primer5.0 software. The primer sequences are as follows

[0039] RYR2:

[0040] M-F: 5'-GTCCCTCTCAGGAGAACACGG-3' (SEQ ID NO: 2),

[0041] M-R: 5'-CTGGTAAGTGAGCCACAAGC-3' (SEQ ID NO: 3).

[0042] (2) Amplification and sequencing of RYR2 gene

[0043] The total volume of the PCR reaction is 25 μL, including 1 μL of DNA template, 12.4 μL of 2×PCR Master Mix, 0.8 μL of upstream primers, 0.8 μL of downstream primers, and 10 μL of ddH2O. The PCR amplification program was: pre-denaturation at 94°C for 3 min, denaturation at 94°C for 30 s, annealing at 54.5°C for 30 s, extension at 72°C for 30 s, 35 cycles, and finally extension at 72°C for 10 min. The PCR reaction product was detected by 1.5% agarose gel electrophoresis, and the results showed that a 387bp specific...

Embodiment 2

[0046] The establishment of embodiment 2 genotyping detection method

[0047] (1) Primer sequence design

[0048] A pair of KASPar primers are designed for the A / C polymorphic site of the amplified fragment in Example 1, so as to be used for the specific detection of the polymorphic site, and the nucleotide sequence of the KASPar primer pair is:

[0049] Forward primer A1 for detection of AlleleA:

[0050] GAAGGTGACCAAGTTCATGCTTCTGAAATAAAATATGGAGACTCGGTA (SEQ ID NO: 4);

[0051] Forward primer A2 for detection of AlleleC:

[0052] GAAGGTCGGAGTCAACGGATTCTGAAATAAAATATGGAGACTCGGTC (SEQ ID NO: 5);

[0053] Universal reverse primer C: GTAAGTGAGCCACAAGCCTGTATTG (SEQ ID NO: 6).

[0054] The above primers were synthesized by entrusting Beijing Sangong Bioengineering Co., Ltd., and the primers of each group in the KASPar primer pair were diluted to 10 μmol / L, and mixed according to the volume ratio of 12:12:30 (primer A1: primer A2: primer C) Evenly reserve.

[0055] (2) DNA qual...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an RYR2 (ryanodine receptor 2) gene as a molecular marker to affect feed conversion rate of sheep, a detection method of the molecular marker and application of the molecularmarker. By subjecting the RYR2 gene of sheep to PCR (polymerase chain reaction) amplification and sequence analysis, it is discovered that an A / C polymorphic site is present at 342 of an amplificationfragment; the amplified RYR2 gene fragment capable of serving as the molecular marker associated with feed conversion rate of sheep is finally determined by detecting polymorphic sites of 437 Hu sheep through KASPar primer, establishing a least squares model and performing association analysis on genotype and feed conversion rate. The molecular marker of the invention is applicable to breeding offeed-saving sheep and cultivation of feed-saving high-quality novel varieties of sheep, helps provide a genetic engineering means to genetically increase the feed conversion rate of sheep, and has important practical application value.

Description

technical field [0001] The invention belongs to the technical field of molecular marker preparation, and specifically relates to RYR2 gene as a molecular marker affecting sheep feed conversion rate and its application. Background technique [0002] With the development of the economy, people's demand for meat is increasing, and mutton is one of the ingredients with relatively large demand. According to statistics, there are currently about 300 million sheep and goats in the country (Zhao Youzhang. Development Trends, Problems and Countermeasures of Sheep Industry at Home and Abroad. Modern Animal Husbandry and Veterinary Medicine, 2015, (09): 63-68). my country has a large population but limited pastures , most of the sheep are fed under the conditions of barn feeding, and are highly dependent on food. How to alleviate the contradiction between humans and animals competing for food to the greatest extent and improve the feed conversion rate of sheep has become more and more i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6888C12N15/11
Inventor张小雪王维民张德印李发弟李冲喇永富李国泽
OwnerGANSU AGRI UNIV