Detection and treatment method of age-related macular degeneration
A senile, microbial technology, applied in the field of diagnosis and treatment of ophthalmic diseases, which can solve the problems of limited improvement of vision and no treatment effect.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0097] A test kit for detecting Propionibacterium acnes, which contains (1) SYBR Green I; (2) Taq enzyme; (3) primer pair SEQ ID NO: 1GATTGGTTTACTACCCGTGAGCG, SEQ ID NO: 2ATAGCAGGGATTCCAGCGACA; (4) dNTP; (5) buffer; (6) sterilized water. The kit is applied to the detection of Propionibacterium acnes by real-time fluorescence quantitative PCR method.
Embodiment 2
[0099] A test kit for detecting Bacillus megaterium, which contains (1) SYBR Green I; (2) Taq enzyme; (3) primer pair SEQ ID NO:3GGTTCAATGAGCCTACT, SEQ ID NO:4GCCAGCGTCTTTTCC; (4) dNTP ; (5) buffer; (6) sterilized water. The kit is applied to the detection of Bacillus megaterium by real-time fluorescent quantitative PCR method.
Embodiment 3
[0101] A test kit for detecting Bacillus licheniformis, which contains (1) SYBR Green I; (2) Taq enzyme; (3) primer pair SEQ ID NO:5TCCCGTCTTCATCTACTGC, SEQ ID NO:6GGACGCCTACTGGACAA; (4) dNTP ; (5) buffer; (6) sterilized water. The kit is applied to the detection of Bacillus licheniformis by real-time fluorescent quantitative PCR method.
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com