Detection and treatment method of age-related macular degeneration
A senile, microbial technology, applied in the field of diagnosis and treatment of ophthalmic diseases, which can solve the problems of limited improvement of vision and no treatment effect.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0097] A test kit for detecting Propionibacterium acnes, which contains (1) SYBR Green I; (2) Taq enzyme; (3) primer pair SEQ ID NO: 1GATTGGTTTACTACCCGTGAGCG, SEQ ID NO: 2ATAGCAGGGATTCCAGCGACA; (4) dNTP; (5) buffer; (6) sterilized water. The kit is applied to the detection of Propionibacterium acnes by real-time fluorescence quantitative PCR method.
Embodiment 2
[0099] A test kit for detecting Bacillus megaterium, which contains (1) SYBR Green I; (2) Taq enzyme; (3) primer pair SEQ ID NO:3GGTTCAATGAGCCTACT, SEQ ID NO:4GCCAGCGTCTTTTCC; (4) dNTP ; (5) buffer; (6) sterilized water. The kit is applied to the detection of Bacillus megaterium by real-time fluorescent quantitative PCR method.
Embodiment 3
[0101] A test kit for detecting Bacillus licheniformis, which contains (1) SYBR Green I; (2) Taq enzyme; (3) primer pair SEQ ID NO:5TCCCGTCTTCATCTACTGC, SEQ ID NO:6GGACGCCTACTGGACAA; (4) dNTP ; (5) buffer; (6) sterilized water. The kit is applied to the detection of Bacillus licheniformis by real-time fluorescent quantitative PCR method.
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap