Unlock instant, AI-driven research and patent intelligence for your innovation.

Detection and treatment method of age-related macular degeneration

A senile, microbial technology, applied in the field of diagnosis and treatment of ophthalmic diseases, which can solve the problems of limited improvement of vision and no treatment effect.

Active Publication Date: 2019-05-03
ZHUHAI QLWEL BIO TECH LTD
View PDF4 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the prior art, vitrectomy is commonly used to treat age-related macular degeneration, but the improvement of visual acuity after the operation is very limited. Sometimes multiple operations are required to keep the patient's only weak vision and eyeballs. still no treatment

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection and treatment method of age-related macular degeneration
  • Detection and treatment method of age-related macular degeneration
  • Detection and treatment method of age-related macular degeneration

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0097] A test kit for detecting Propionibacterium acnes, which contains (1) SYBR Green I; (2) Taq enzyme; (3) primer pair SEQ ID NO: 1GATTGGTTTACTACCCGTGAGCG, SEQ ID NO: 2ATAGCAGGGATTCCAGCGACA; (4) dNTP; (5) buffer; (6) sterilized water. The kit is applied to the detection of Propionibacterium acnes by real-time fluorescence quantitative PCR method.

Embodiment 2

[0099] A test kit for detecting Bacillus megaterium, which contains (1) SYBR Green I; (2) Taq enzyme; (3) primer pair SEQ ID NO:3GGTTCAATGAGCCTACT, SEQ ID NO:4GCCAGCGTCTTTTCC; (4) dNTP ; (5) buffer; (6) sterilized water. The kit is applied to the detection of Bacillus megaterium by real-time fluorescent quantitative PCR method.

Embodiment 3

[0101] A test kit for detecting Bacillus licheniformis, which contains (1) SYBR Green I; (2) Taq enzyme; (3) primer pair SEQ ID NO:5TCCCGTCTTCATCTACTGC, SEQ ID NO:6GGACGCCTACTGGACAA; (4) dNTP ; (5) buffer; (6) sterilized water. The kit is applied to the detection of Bacillus licheniformis by real-time fluorescent quantitative PCR method.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method and reagent kit for detecting eye microorganisms, and an application of the reagent kit to diagnosis of age-related macular degeneration. The method for detecting eye microorganisms is a metagenome sequencing method and / or a real-time fluorescent quantitation PCR method. The invention further provides a medicine for killing or restraining microorganisms to treat theage-related macular degeneration, and a new method is provided for treatment of the age-related macular degeneration.

Description

technical field [0001] The invention belongs to the technical field of diagnosis and treatment of eye diseases, and in particular relates to a method for detecting microorganisms that cause eye diseases and a drug for treating the diseases. Background technique [0002] For a long time, it has been generally believed that there are no microorganisms on healthy eyeballs, because tears and blinking can remove foreign matter such as microorganisms. However, with recent research, it has been found that there are microorganisms in healthy eyes. Some of these microorganisms are commensal bacteria, while some are pathogenic bacteria. [0003] Age-related macular degeneration (AMD) is the aging change of the macular structure, divided into dry AMD and wet AMD, and is the main cause of irreversible vision loss in the elderly. [0004] Dry AMD results from long-term chronic progressive atrophy of the RPE-Bruch's membrane-choriocapillary complex. Dry AMD mostly occurs in the elderly ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6883C12Q1/04C12N15/11A61K45/00A61P27/02A61P31/04
CPCA61P27/02A61P31/04C12Q1/04C12Q1/6883C12Q1/689C12Q1/6895C12Q1/701A61K31/7036A61K31/43A61K31/65G01N2800/164G01N33/56911Y02A50/30A61K45/00C12N15/11C12Q1/6888G01N2333/32G01N2800/16
Inventor 魏来
Owner ZHUHAI QLWEL BIO TECH LTD