Closely linked molecular marker of wheat spike grain number main effect QTL and application of closely linked molecular marker

A technology of molecular markers and traits of grain number per ear, which is applied in the determination/inspection of microorganisms, DNA/RNA fragments, recombinant DNA technology, etc., to achieve the effects of saving production costs, fast and accurate screening, and clear selection targets

Active Publication Date: 2019-06-21
LUDONG UNIVERSITY
View PDF4 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Currently, there are relatively few reports on Q

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Closely linked molecular marker of wheat spike grain number main effect QTL and application of closely linked molecular marker
  • Closely linked molecular marker of wheat spike grain number main effect QTL and application of closely linked molecular marker
  • Closely linked molecular marker of wheat spike grain number main effect QTL and application of closely linked molecular marker

Examples

Experimental program
Comparison scheme
Effect test

Example Embodiment

[0036] Example 1 Molecular markers closely linked to the major QTL for wheat spike number

[0037] Use 4A671931696 labeled primer:

[0038] Upstream primer sequence: GCTGGGGTTTCTCTGCAAAA (as described in SEQ ID NO:1),

[0039] Downstream primer sequence: TGGGGAGTGGCATCTTGTAG (as described in SEQ ID NO: 2),

[0040] Use PAX-110572601 labeled primers:

[0041] Upstream primer L 1 Sequence: TTATCTACTACCCATTTCCACCCTAAC (as described in SEQ ID NO: 3),

[0042] Upstream primer L 2 Sequence: TACTACCCATTTCCACCCCCAT (as described in SEQ ID NO: 4),

[0043] Downstream primer R sequence: TGGTTGTAATCAGTCCATGT (as described in SEQ ID NO: 5);

[0044] The 4A671931696 labeled primer was used for PCR amplification of the DNA of wheat variety Jing 411. The PCR amplification system was 10 μl, including: 1 μl DNA template, 1 μl upstream primer, 1 μl downstream primer, 5 μl 2×Taq PCR StarMix, 2 μl DdH 2 O; Amplification by ordinary amplification program: denaturation at 95°C for 5 min; 34 cycles of ordinary ...

Example Embodiment

[0048] Example 2 Screening method and application of molecular markers closely linked to the main QTL for wheat spike number

[0049] It includes the following steps:

[0050] (i) Crossing the wheat variety Jing 411 with more grains per spike as the female parent and Kenong 9204 with fewer grains per spike as the male parent to obtain hybrid F1, F2 produced by F1 selfing, and F2 selfed generation by generation F6 generation RIL population with 188 families;

[0051] (ii) Use a modified CTAB method, that is, a modified cetyltrimethylammonium bromide method (Vander Beek et al., 1992) to extract DNA from each strain of the above-mentioned RIL population, using InDel labeling, based on expressed sequence tags PCR amplification marker (STS marker) performs genotype analysis on the family to obtain the genotype value material of the RIL population ( figure 1 ); sequence tag site (sequence tag site, STS), also known as sequence target site, uses primers for PCR amplification to combine wit...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a closely linked molecular marker of a wheat spike grain number main effect QTL and application of the closely linked molecular marker. The invention also provides a primer group for identifying or assisting in identifying traits of grain number per spike of wheat. The primer group is a primer group capable of amplifying to obtain the following DNA fragments: the DNA fragments are DNA fragments obtained by taking wheat genome DNA as a template and carrying out PCR amplification on primer pairs as shown in SEQ ID NO: 1 and SEQ ID NO: 2, and DNA fragments obtained by carrying out PCR amplification on primer pairs as shown in SEQ ID NO: 3-5. The product obtained by taking the wheat genome DNA as the template and carrying out PCR amplification by adopting the primer group is the molecular marker related to the traits of grain number per spike of the wheat, the molecular marker can be used for the traits of grain number per spike of wheat, and excellent gene resources and selection tools are provided for molecular breeding of yield trait of the wheat.

Description

technical field [0001] The invention belongs to the technical field of wheat molecular biotechnology and breeding, and in particular relates to a tightly linked molecular marker of the main effect QTL of wheat panicle number and its application. Background technique [0002] Wheat is one of the most important food crops in the world, and improving wheat production is an important way to meet human food needs. Wheat yield is composed of the number of spikes per unit area, the number of grains per spike, and the thousand-grain weight. Among them, the number of grains per panicle, as one of the three factors of wheat yield, has a great contribution to the formation of yield. Therefore, excavating the excellent alleles that control the number of grains per ear and developing functional molecular markers can greatly speed up the breeding process of excellent wheat varieties, and provide excellent genetic resources and selection tools for molecular breeding of wheat yield traits....

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6895C12N15/11
Inventor崔法张萌娜赵春华孙晗吴永振张倩倩刘锡建
OwnerLUDONG UNIVERSITY