Application of mg132 as synergist and stabilizer in vaccine production
A technology of MG132 and synergist, applied in the field of biomedicine, can solve the problems of high production cost, low vaccine production efficiency, unsuitable for large-scale promotion, etc., and achieve the effect of promoting vaccine production and good vaccine stability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] Example 1 Effect of MG132 on the expression of FMDV structural protein VP3
[0029] 1.1 Experimental steps
[0030] (1) HEK-293T cells were plated in a 12-well plate, and co-transfected with pCDNA3.1-HA-TBK1 plasmid (0.25 μg) and pCDNA3.1-Flag-VP3 plasmid (1 μg) after 12 h;
[0031] (2) 18h after transfection, add DMSO (50μM, as control), MG132 (50μM), 3-MA (0.5mg / ml), NH 4 Cl (25mM), reacted for 6h;
[0032] (3) After the reaction was completed, the above samples were collected respectively, and after lysis with SDS-loading buffer, the expression of VP3 protein was detected by WB method.
[0033] 1.2 Experimental results
[0034] The result is as figure 1 shown, the expression of the FMDV structural protein VP3 was significantly increased after the addition of MG132, while the addition of DMSO, 3-MA and NH 4 Cl had no significant effect on the expression of structural protein VP3, indicating that only MG132 could increase the expression of VP3 protein.
Embodiment 2
[0035] Example 2 The effect of MG132 on the expression of structural proteins in FMDV-infected cells
[0036] 2.1 TBK1 - / - Construction of MEF
[0037] 2.1.1 Experimental steps
[0038] (1) Annealing coupling, mix the CRISPR / Cas9 F (CGGCGAGTCAACTCCGGCCA) and R (TGGCCGGAGTTGACTCGCCG) guide sequences (5 μL) at a concentration of 10 μM with 0.5 M NaCl (6 μL) and water (24 μL), and place the annealed primers into Put it in a 95°C water bath for 5min, then take it out and cool down to room temperature naturally;
[0039] (2) According to the instructions, use Fast Digest Bsm BI to cut the sticky ends of the pGL-U6-gRNA vector; mix 5 μL of the annealed primers and 2 μL of the digested vector with T4 ligase, and connect at room temperature for 30 min;
[0040] (3) Mix 5 μL of the ligation product with 50 μL of competent DH5α, heat shock for 30 seconds, and plate;
[0041] (4) Picking a single clone, sequencing, and extracting the plasmid, the obtained recombinant plasmid is pGL-U...
Embodiment 3
[0055] Example 3 Effects of MG132 on the Expression of Other Picornaviridae VP3 Proteins
[0056] 3.1 Experimental steps
[0057] (1) 293T cells were plated in 12-well plates, and transfected with pCDNA3.1-HA-TBK1 plasmid (0.25 μg), pCDNA3.1-EV71-Myc-VP3 plasmid (1 μg), and pCDNA3.1-EMCV-Myc after 12 hours - VP3 plasmid (1 μg), and pCDNA3.1-SVV-Myc-VP3 plasmid (1 μg);
[0058] (2) 18 hours after transfection, DMSO (50 μM, as a control) and MG132 (50 μM) were added for 6 hours;
[0059] (3) Collect samples and detect the expression of VP3 protein in each sample.
[0060] 3.2 Experimental results
[0061] Experimental results such as Figure 4 As shown, compared with DMSO, the expression levels of VP3 proteins of picornaviridae viruses EV71, EMCV and SVV were significantly increased after adding MG132.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


