Supercharge Your Innovation With Domain-Expert AI Agents!

A Seed Sorting Method for Fixed Plant Heterosis

A hybrid vigor and seed technology, applied in the field of plant molecular biology and agricultural biology, can solve the problems such as the inability to realize the application of the hybrid apomixis system, the inability to sort seeds, and the ratio of cloned seeds is not 100%. The effect of reducing complex seed production procedures, broad application and market prospects, and reducing production costs

Active Publication Date: 2020-06-05
HUNAN HYBRID RICE RES CENT
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the ratio of cloned seeds in this apomixis system is not 100%, and cloned seeds and seeds formed by normal pollination and fertilization cannot be sorted
So that it is still impossible to realize the application of hybrid apomixis system

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A Seed Sorting Method for Fixed Plant Heterosis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Construction of a rice expression vector carrying three linked gene expression cassettes: embryo autonomous gene E1, fluorescent selection marker gene E2, and regulatory selection marker gene expression cassette E3:

[0038] 1. Selection of specific promoters and target genes

[0039] Through literature review and web search, an oocyte-specific expression promoter was determined AtDD45Pro , whose nucleotide sequence is shown in SEQ ID NO.1; determine an embryogenesis gene BBM1 , whose nucleotide sequence is shown in SEQ ID NO.2; an embryo-specific expression promoter was determined OsESP1 , its nucleotide sequence is shown in SEQ ID NO.3; the red fluorescent gene RP is determined to be a screening marker gene, and its nucleotide sequence is shown in SEQ ID NO.4; a pollen-specific expression promoter is determined, and its nucleotide sequence is shown in SEQ ID NO.5.

[0040] 2. Construction of apomixis vector p24DB

[0041] Respectively PAIR1 , REC8 , OSD1 D...

Embodiment 2

[0058] Obtaining transgenic plants:

[0059] Selection of rice expression vectors p24DB After a single colony of Agrobacterium was inoculated on LB medium containing 50 mg / L kanamycin and cultured in the dark at 26°C for 2 days, the Agrobacterium cells were washed with NB-AS liquid medium, and cultured with shaking at 180 rpm at 28°C for 90-120 min. Adjust the colony concentration to OD600 of 0.8-1.0, transform hybrid rice, sterilize the hybrid rice seeds, select the seeds with plump grains, soak in 75% alcohol for 30 s, pour off the alcohol, rinse with sterile water, and rinse with HgCl 2 Disinfect for 8 minutes, wash with sterile water twice, soak for 1 minute each time, and soak in sterile water for 1 hour. The sterilized seeds were inoculated on the induction medium and grown under light for 7 days.

[0060] Pool the sterile callus together. Put it into the Agrobacterium suspension, soak for 5-10 min, take it out, and dry it with filter paper. Inoculate into the co-cu...

Embodiment 3

[0063] Molecular testing of transgenic plants:

[0064] DNA extraction: Take 1.0 g leaves, grind them into powder with liquid nitrogen, transfer them to 2 ml EP tubes, and add 700 μl preheated CTAB solution. Place in a water bath at 65°C for 30-60 min, mix gently during the period, add an equal volume of chloroform:isoamyl alcohol (24:1) after cooling, mix well, centrifuge at 12000 rpm for 10 min, take the supernatant into a new centrifuge tube, Add 500 μl of isopropanol and let stand at -20°C for 30-60min. 4°C, 12000 rpm, 10 min to collect the precipitate, discard the supernatant. Wash the precipitate twice with 70% ethanol, dry the alcohol residue, 50-100 μl ddH 2 O dissolved the precipitate and set aside.

[0065] PCR analysis: with RP The gene was used as a template to design primers, and the amplified product fragment was 431 bp.

[0066] Forward primer:

[0067] F: 5' CCCAGTTCCAGTACGGCTCCAAG 3';

[0068] Reverse primer:

[0069] R: 5'CTCGTTGTGGGAGGTGATGTCCAG 3'....

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Provided is a method for sorting cloned seeds using a pollen specific gene switching system. Three closely linked gene expression cassettes and a MiMe knockout vector that knocks out three key meiotic genes, REC8, PAIR1 and OSD1, are simultaneously transferred into a hybrid plant. The three gene expression cassettes comprise: 1) an embryonic autonomous gene expression cassette E1; 2) a screening marker gene expression cassette E2, which is regulated by E3; and 3) an expression cassette E3 for pollen-specific regulation of E2. The screening marker regulated by the pollen specific genetic switching system is used to sort asexual embryo seeds and zygotic embryo seeds from the self-fruiting seeds of hybrid transgenic plants. The cloned seeds retain heterosis and can be used for production, and the remaining seeds can be used for commercial purposes.

Description

technical field [0001] The invention belongs to the fields of plant molecular biology and agricultural biotechnology, and in particular relates to a method for using a pollen-specific gene switch system to regulate and screen marker genes, and then sort cloned seeds, so as to realize the application of hybrids without a fusion system. Background technique [0002] A complete plant contains sporophyte generations (2n), which have specific reproductive structures (floral organs), in which pistils and stamens undergo meiosis and genetic recombination to produce megaspores (1n) and microspores (1n), respectively; The large and small spores undergo several mitosis to form female and male gametophytes, and the female gametophyte (embryo sac) contains 7 cells (1 egg cell, 2 synergid cells, 1 central cell with 2 nuclei, 3 antipodal cells) and Buried deep in the ovule tissue of the mother, the male gametophyte (pollen) contains 1 vegetative cell and 2 sperm; ) combined to form a zyg...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/29C12N15/82A01H5/10
CPCC07K14/415C12N15/8231
Inventor 曹孟良夏玉梅詹祎捷唐宁卜小兰余木兰袁隆平
Owner HUNAN HYBRID RICE RES CENT
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More