Rice grain type growth and development related coding gene and its application
A technology of growth and development and coding genes, applied in the field of genetic engineering, can solve problems such as poor performance of agronomic traits and few grain type genes
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0057] Construction of overexpression vector of rice grain growth and development related gene OrMKK3-4
[0058] 1. Acquisition of OrMKK3-4, a gene related to grain shape growth and development in rice
[0059] Using the reverse-transcribed cDNA of medicinal wild rice Y003 (Oryza officinalis Wall.ex wstt) as a template, PCR amplification was performed with the following primers primer1 and primer2 to obtain the target gene.
[0060] primer1: 5'TTGGCGCGCCCTGCAGGTTTAAACGAATTGCCCTT 3';
[0061] primer2: 5'CCTTAATTAATGCTGCTCTCCCTTCCTTTTGTGCT 3'.
[0062] After recovering and purifying the PCR product, it was connected to Zero (purchased from Beijing Quanshijin Company) sequencing vector, transformed into DH5α competent cells, and the positive clones were selected for sequencing.
[0063] Sequencing results showed that the amplified PCR product had 4 alternative cuts, and the fourth was the nucleotide sequence shown in SEQ ID No.1, with a length of 1480 bp, named OrMKK3-4 gene. ...
Embodiment 2
[0069] Breeding OrMKK3-4 overexpression transgenic plants with increased expression level of rice grain growth and development related gene OrMKK3-4 and identification of transgenic plants
[0070] 1. Cultivate overexpressed OrMKK3-4 transgenic plants with elevated OrMKK3-4 gene expression levels. Transform the recombinant vector PMDC32-OrMKK3-4 into Nipponbare japonica rice mediated by Agrobacterium tumefaciens EHA105. The specific method is as follows:
[0071] 1. Import the recombinant vector PMDC32-OrMKK3-4 obtained in Example 1 into Agrobacterium tumefaciens EHA105 by heat shock method to obtain recombinant Agrobacterium tumefaciens EHA105 containing the recombinant vector PMDC32-OrMKK3-4; The recombinant Agrobacterium tumefaciens EHA105 of 4 was cultured at 28°C for 16 hours, and the cells were collected; the cells were diluted with N6 liquid medium (Sigma, catalog number C1416) containing 100 μM acetosyringone to obtain the diluted cell solution , the OD600 of the dilut...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



