Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Rice grain type growth and development related coding gene and its application

A technology of growth and development and coding genes, applied in the field of genetic engineering, can solve problems such as poor performance of agronomic traits and few grain type genes

Inactive Publication Date: 2019-08-16
GUANGXI ZHUANG AUTONOMOUS REGION ACAD OF AGRI SCI
View PDF3 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the individual comprehensive agronomic traits of the genes that have been discovered and identified to control rice grain shape traits are poor. The main problem of grain shape breeding today is that there are too few applicable grain shape genes. How to break through the bottleneck and apply new grain shape genes is particularly important. The essential

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rice grain type growth and development related coding gene and its application
  • Rice grain type growth and development related coding gene and its application
  • Rice grain type growth and development related coding gene and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] Construction of overexpression vector of rice grain growth and development related gene OrMKK3-4

[0058] 1. Acquisition of OrMKK3-4, a gene related to grain shape growth and development in rice

[0059] Using the reverse-transcribed cDNA of medicinal wild rice Y003 (Oryza officinalis Wall.ex wstt) as a template, PCR amplification was performed with the following primers primer1 and primer2 to obtain the target gene.

[0060] primer1: 5'TTGGCGCGCCCTGCAGGTTTAAACGAATTGCCCTT 3';

[0061] primer2: 5'CCTTAATTAATGCTGCTCTCCCTTCCTTTTGTGCT 3'.

[0062] After recovering and purifying the PCR product, it was connected to Zero (purchased from Beijing Quanshijin Company) sequencing vector, transformed into DH5α competent cells, and the positive clones were selected for sequencing.

[0063] Sequencing results showed that the amplified PCR product had 4 alternative cuts, and the fourth was the nucleotide sequence shown in SEQ ID No.1, with a length of 1480 bp, named OrMKK3-4 gene. ...

Embodiment 2

[0069] Breeding OrMKK3-4 overexpression transgenic plants with increased expression level of rice grain growth and development related gene OrMKK3-4 and identification of transgenic plants

[0070] 1. Cultivate overexpressed OrMKK3-4 transgenic plants with elevated OrMKK3-4 gene expression levels. Transform the recombinant vector PMDC32-OrMKK3-4 into Nipponbare japonica rice mediated by Agrobacterium tumefaciens EHA105. The specific method is as follows:

[0071] 1. Import the recombinant vector PMDC32-OrMKK3-4 obtained in Example 1 into Agrobacterium tumefaciens EHA105 by heat shock method to obtain recombinant Agrobacterium tumefaciens EHA105 containing the recombinant vector PMDC32-OrMKK3-4; The recombinant Agrobacterium tumefaciens EHA105 of 4 was cultured at 28°C for 16 hours, and the cells were collected; the cells were diluted with N6 liquid medium (Sigma, catalog number C1416) containing 100 μM acetosyringone to obtain the diluted cell solution , the OD600 of the dilut...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a rice grain type growth and development related coding gene, and the name of the rice grain type growth and development related coding gene is OrMKK3-4; and the rice grain type growth and development related gene OrMKK3-4 is used for regulating rice grain growth and development. The application firstly identifies the rice grain type growth and development related gene OrMKK3-4, and the rice grain type growth and development related gene OrMKK3-4 can obtain the short grain rice under the condition of enhanced function or increased expression, which proves that the ricegrain type growth and development related gene protein or its protein plays an important role in controlling rice grain size.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a coding gene related to grain shape growth and development of rice and its application. Background technique [0002] Rice is one of the most important food crops for human beings, accounting for about 50% of the world's population whose staple food is rice. The demand for rice in Asia is increasing year by year. Due to rapid economic development, increasing population pressure, sharp increase in industrial land, and decrease in arable land, rice production is facing tremendous pressure. Therefore, continuously improving and tapping the high-yield potential of rice is the main research direction of scientists. Grain size and shape are not only a stable agronomic trait, a key factor determining rice yield, but also an important quality trait. Grain weight is an important yield factor, and grain weight is highly positively correlated with grain shape, both of which a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/415C12N15/29C12N15/82A01H5/10A01H6/46
CPCC07K14/415C12N15/8261
Inventor 梁云涛潘英华徐志健陈达庆
Owner GUANGXI ZHUANG AUTONOMOUS REGION ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com