Kit for detecting MTRR gene A66G rs1801394SNP site
A kit and gene technology, applied in the field of water quality testing, can solve the problems of difficult to replicate operation, high difficulty in operation, poor operation effect, etc., and achieve the effect of not easy to make mistakes, strong objectivity, and strong sample processing ability.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] A kit for detecting the A66G rs1801394SNP site of the MTRR gene, characterized in that it includes primers and probes designed according to the polymorphism of the A66G rs1801394SNP site of the MTRR gene, and the sequence is as follows:
[0025] MTRR gene A66G forward amplification primer: GCAGGGACAGGCAAAGG;
[0026] MTRR gene A66G reverse amplification primer: CTGTGGTACATGGATTTTCTGC;
[0027] MTRR gene 66A probe: 5'-AAGAAATATGTGAGCAA-3';
[0028] MTRR gene 66G probe: 5'-AAGAAATGTGTGAGCAA-3'.
[0029] The fluorescent group at the 5' end of the MTRR gene 66A probe is VIC, and the quencher group at the 3' end is Quencher and MGB.
[0030] The fluorescent group at the 5' end of the MTRR gene 66G probe is FAM, and the quencher group at the 3' end is Quencher and MGB.
[0031] The ratio of MTRR gene A66G primer probe mixture is: MTRR gene A66G forward amplification primer: MTRR gene A66G reverse amplification primer: MTRR gene 66A probe: MTRR gene 66G probe: water = 10:10...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



