Unlock instant, AI-driven research and patent intelligence for your innovation.

Kit for detecting MTRR gene A66G rs1801394SNP site

A kit and gene technology, applied in the field of water quality testing, can solve the problems of difficult to replicate operation, high difficulty in operation, poor operation effect, etc., and achieve the effect of not easy to make mistakes, strong objectivity, and strong sample processing ability.

Pending Publication Date: 2019-09-10
CHANGSHA KINGMED MEDICAL DIAGNOSTICS INST
View PDF7 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0010] The main problem to be solved by this application is to provide a kit for detecting the A66G rs1801394SNP site of the MTRR gene. The practical operation effect of the ordered kit is not good, the operation is difficult, and the technical problems that are difficult to replicate

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for detecting MTRR gene A66G rs1801394SNP site
  • Kit for detecting MTRR gene A66G rs1801394SNP site
  • Kit for detecting MTRR gene A66G rs1801394SNP site

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] A kit for detecting the A66G rs1801394SNP site of the MTRR gene, characterized in that it includes primers and probes designed according to the polymorphism of the A66G rs1801394SNP site of the MTRR gene, and the sequence is as follows:

[0025] MTRR gene A66G forward amplification primer: GCAGGGACAGGCAAAGG;

[0026] MTRR gene A66G reverse amplification primer: CTGTGGTACATGGATTTTCTGC;

[0027] MTRR gene 66A probe: 5'-AAGAAATATGTGAGCAA-3';

[0028] MTRR gene 66G probe: 5'-AAGAAATGTGTGAGCAA-3'.

[0029] The fluorescent group at the 5' end of the MTRR gene 66A probe is VIC, and the quencher group at the 3' end is Quencher and MGB.

[0030] The fluorescent group at the 5' end of the MTRR gene 66G probe is FAM, and the quencher group at the 3' end is Quencher and MGB.

[0031] The ratio of MTRR gene A66G primer probe mixture is: MTRR gene A66G forward amplification primer: MTRR gene A66G reverse amplification primer: MTRR gene 66A probe: MTRR gene 66G probe: water = 10:10...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A purpose of the invention is to disclose a kit for detecting an MTRR gene A66G rs1801394SNP site. The kit us characterized in that: the kit includes primers and probes designed according to polymorphism of the MTRR gene A66G rs1801394SNP site, sequences are as follows: an MTRR gene A66G forward amplification primer: GCAGGGACAGGCAAAGG; an MTRR gene A66G reverse amplification primer: CTGTGGTACATGGATTTTCTGC; an MTRR gene 66A probe: 5'-AAGAAATATGTGAGCAA-3'; an MTRR gene 66G probe: 5'-AAGAAATATGTGAGCAA-3'; and operation is simple, generalizability is strong, results are accurate, compatibility isgood, and a risk of pollution is low.

Description

technical field [0001] The invention belongs to the field of water quality detection, and specifically refers to a kit for detecting the A66G rs1801394 SNP site of MTRR gene. Background technique [0002] Folic acid belongs to the water-soluble B vitamins, plays an important role in the biosynthesis of nucleic acids and proteins, and is the material basis for cell proliferation and body development. China is one of the countries with a high incidence of birth defects in newborns, and folic acid deficiency is the main cause of birth defects. There are two main reasons for the lack of folic acid in the body: one is insufficient intake of folic acid, and the other is the low efficiency of the body's use of folic acid due to genetic defects, that is, folic acid metabolism disorder. [0003] The full name of MTRR is methionine synthase reductase, which is the key enzyme to maintain the activity of methionine synthase. Methionine synthase plays an important role in folic acid met...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6883C12Q1/6858
CPCC12Q1/6883C12Q1/6858C12Q2600/156C12Q2531/113C12Q2563/107
Inventor 余艳程柳柳周梅华代冰李慧源
Owner CHANGSHA KINGMED MEDICAL DIAGNOSTICS INST