44 results about "Folic acid metabolism" patented technology

The invention provides a method for typing three sites of key enzyme genes (MTHFR and MTRR) for folic acid metabolism by utilizing a fluorescence labeling probe and combining with a multiple PCR method. An amplimer and a fluorescent probe are designed according to MTHFR and MTRR genes; three sections of DNA sequences are detected in the amplification of a PCR amplifier; fluorescence signals which are released in amplification and dissolution processes in a reaction system are detected; a result is judged in the manner of (1) judging a typing result according to a Tm value shown by a hybrid peak of wild type and mutant type standard plasmids and (2) simultaneously typing according to the magnitude of a fluorescence value of an amplification curve. The primer and the probe adopted by the invention are high in specificity and sensitivity; the detection for three sites is simultaneously performed; the operation is simple and the result is easily judged; the typing result is more accurate and reliable in the manner of twice calibrating typing. The method provided by the invention can be applied to the aspects of guiding the pregnant woman to orally take and supplement folic acid, prompting the high risk in cerebral apoplexy, coronary heart disease and venous thrombus, assessing the metabolic activity of folic acid, and the like.

Compositions and methods for the treatment of osteoporosis and / or inflammatory joint disease are provided herein. The compositions contain a folate, such as a reduced folate, and folic acid. The folate is preferably 5-methyltetrahydrofolate, and most preferably 5-methyl-(6S)-tetrahydrofolic acid. The folate and folic acid can be given in the same dosage unit or separate dosage units, and more than one dosage unit can be given per dose. The compositions may also contain one or more vitamins and minerals selected from vitamin B12, vitamin B6, vitamin D3, calcium, magnesium, and polyunsaturated fatty acids (PUFAs). These ingredients are optional, but preferable (especially the vitamins and minerals). The compositions may further contain one or more additional ingredients such as vitamins, minerals, and laxatives. The compositions are useful in the treatment of all forms of osteoporosis, including primary osteoporosis and secondary osteoporosis, and / or inflammatory joint diseases, especially in patients having a folic acid metabolism deficiency. The compositions are particularly useful in the treatment of inflammatory joint diseases, with complications that include bone loss, fracture, and osteoporosis. In addition, the compositions are beneficial for the prevention of osteoporosis in subjects who do not yet have the disease, but who are at risk for getting osteoporosis, such as post-menopausal women, subjects with osteopenia (mid thinning of the bone mass), subjects with an inflammatory joint disease, or people who are over the age of 70.

The invention belongs to the technical field of human nucleic acid in vitro detection, and specifically relates to a PCR (polymerase chain reaction) amplification system for genotyping of three SNP (single-nucleotide polymorphism) loci related to human folic acid metabolism and a detection kit. A complex PCR amplification system comprising three SNP loci and three sample molecular marker sites is firstly designed, the three SNP loci adopt allele-specific primers, the three molecular marker sites adopt length polymorphic primers, and the primers are mutually compatible and can react in the same PCR amplification system. The detection kit comprises a primer composition container, a PCR reaction mother solution container, and a PCR auxiliary solution container, wherein the primer composition container comprises a primer SEQ ID No. 1 to SEQ ID No. 15 composition stock solution. In the case of DNA-free extraction, the three SNP loci are simultaneously amplified and typed by a PCR reaction, so that the cost, manpower and time can be obviously saved, and the working efficiency can be improved.

The invention relates to a method for producing epsilon-poly-L-lysine. The method is characterized in that a medium containing 1-10g / L of glycine is added at an early or middle stage of culture. By adding glycine in a fermentation process in the invention, glycine which enters a folic acid metabolism approach allows sufficient one-carbon groups to be supplied to a biosynthesis process, the anabolism activity of bacterial strains to be improved, the synthesis of a precursor L-lysine and epsilon-poly-L-lysine to be increased, and the accumulation amount of epsilon-poly-L-lysine to be 20-50% higher than the accumulation amount obtained through original technologies.

The invention discloses an MTHFR, MTRR and RFC1 gene polymorphism detection primer combination and kit and application of the MTHFR, MTRR and RFC1 gene polymorphism detection kit. The detection kit comprises ultrapure water, an X solution, a 10*PCR buffering solution, a PCR primer, a 25 mM magnesium chloride solution, DNA polymerase and a positive control product, wherein the PCR primer comprises a forward and reverse amplification primer, a DNA internal reference forward and reverse amplification primer and a reaction internal reference forward and reverse amplification primer of different gene types, the three primers are located at four SNP sites on a gene related to folic acid metabolism, and the gene sequence of the PCR primer is shown in SEQ ID NO.1-NO.20. The detection kit has the advantages of being high in specificity, accuracy, flux and reliability, low in cost and free of a false-negative result.

The invention provides a gene noninvasive detection kit for preventing neural tube defects of newborns. The kit comprises specific primers, DNA sequencing primers, a PCR (Polymerase Chain Reaction) reaction assembly, a PCR product purification assembly, a DNA sequencing reaction assembly and the like, wherein the specific primers are used for detecting No. rs1801133 SNP locus (MTHFR C677T) and No. rs1801131 SNP locus (MTHFR A1298C) on 5, 10-methylene tetrahydrofolate reductase (MTHFR) and No. rs1801394 SNP locus (MTRR A66G) on 5, 10-methylene methyl transferase reductase (MTRR). The kit evaluates the risk level of pregnant women giving birth to infants with neural tube defects by detecting the genotype of a single nucleotide polymorphism locus closely related to the main genetic factor causing newborn defects, namely female folic acid metabolism ability, and the pregnant women are individually instructed to supplement folic acid according to the gene detection result of each client. The method provided by the invention accords with the situation of our country, oral mucosa cell sampling is adopted as a sampling method which is painless and noninvasive, and cross infection is avoided. The sequencing detection results are accurate and reliable, expensive imported special instruments are not needed, and the method is easy to popularize and spread.

The invention provides a kit and method for determining mutation sites of genes of acetaldehyde dehydrogenase 2 and methylene tetrahydrofolic acid reductase by virtue of a single tube at the same time and belongs to the field of molecular biology test. The kit comprises a whole blood genome DNA (deoxyribonucleic acid) extraction reagent, a multiple PCR (polymerase chain reaction) amplification primer, a multiple PCR amplification reaction reagent, a single-strained DNA separation and purification reagent, a pyrosequencing primer, a pyrosequencing reagent and a kit body. The method comprises the following steps: extracting human whole blood genome DNA, carrying out multiple PCR amplification reaction, separating and purifying a single-strained DNA sample, pyrosequencing and analyzing results. The kit can be used by a person subjected to physical examination and hope to know individual ethyl alcohol and folic acid metabolic capability, can be used for predicting individual nitroglycerin metabolic capability and curative effect and guiding a patient suffering from myocardial infarction to reasonably select and prepare vasodilatation first-aid medicaments and can also be used for predicting the individual folic acid metabolic capability and guiding pregnant and lying-in women to supplement the right dosage of folic acid supplements.

The invention provides application of maize gene ZmGFT1 in increasing folic acid content in plants. 5-Formyltetrahydrofolate content in 513 selfing line materials of a maize natural variant group is measured, the influence of group structure and genetic relationship of the natural variant group is estimated in connection with genotype data mined from RNA-Seq data, gene GFT1 having significant influence on the 5-formyltetrahydrofolate content and located on maize 5th chromosome is located by means of genome-wide association study, and the gene GFT1 encodes glutamate formiminotransferase 1. The invention also provides an SNP marker associated with maize folic acid content and its application. The maize gene ZmGFT1 and discovery of the key SNP site therein having significant influence on the 5-formyltetrahydrofolate content not only provide theoretical basis for studying folic acid metabolism in maize and other crops, but also enable the hidden hunger problem of human in terms of folic acid nutrition to be solved through the increase in the folic acid content of transgenic plants.

The invention relates to a folic acid metabolic capability and genotyping detection technology and in particular relates to a kit and a detection method of a folic acid metabolic capability and genotyping as well as application of the kit. The kit comprises specific primers aiming at 677C>T mutation and 1298A>C mutation of an MTHFR (Methylene Tetrahydrofolate Reductase) gene, and 66A>G mutation ofan MTRR (Methionine Synthase Reductase) gene, and a specific mutation detection probe, RT-PCR (Reverse Transcription-Polymerase Chain Reaction) buffer, an RT-PCR reaction Taq enzyme, sterile purifiedwater, a negative quality control product, a wild type quality control product, a mutant quality control product and a packaging box for separating and packaging a reagent bottle or pipe. The detection method of the folic acid metabolic capability and the genotyping, provided by the invention, has the advantages of strong specificity, high sensitivity, small pollution, simplicity and rapidness inoperation, high safety performance and the like; a detection result has relatively good accuracy and repeatability; the detection method is especially suitable for directly taking whole blood as a detection sample and related gene mutation detection is directly carried out; a genome DNA (Deoxyribonucleic Acid) template does not need to be extracted. The folic acid metabolic capability can be accurately judged and individualized folic acid oral administration and supplementing dosages are provided; the kit and the detection method have important value.

The invention relates to an application of antifolic in constructing a mouse model with neural tube defects (NTDs). Specifically, an anti-folic acid metabolism drug is adopted for intervening a pregnant mouse to generate folic acid dysbolism and cause abnormal embryonic development of the mouse, thereby constructing a mouse model with NTDs. The method adopted by the invention has simplicity of operation, good repeatability, high teratogenesis rate and stable effect, and simulates an animal model close to human on the pathogenesis of NTDs by obstructing normal metabolism of folic acid, thereby facilitating further studies on congenital anomalies, especially NTDs.

The invention discloses an amplification primer, a kit and a detection method for evaluating folic acid metabolism ability, belonging to the field of biotechnology. The amplification primer for evaluating folic acid metabolism ability comprises a first primer pair for detecting rs1801133, a second primer pair for detecting rs1801131, a third primer pair for detecting rs1801394 and a fourth primerpair for detecting rs1805087. The invention also discloses a kit for evaluating folic acid metabolism ability and a method for evaluating folic acid metabolism ability. The amplification primer for evaluating folic acid metabolism ability has the advantages of high sensitivity, high specificity, high accuracy and simple operation, and can realize gene detection of four polymorphic sites related tofolic acid metabolism, screen out mutation sites, realize individualized supplementation of folic acid, and reduce the risk of birth defects of newborns.

The invention discloses primers for detecting folic acid metabolism related gene SNP, fluorescent probes and applications. The provided primers have four groups. Each group of the primers has a corresponding fluorescent probe group for carrying out rapid gene typing on rs1801133, rs11018628 and rs1047891. Detected results obtained by the primers and the fluorescent probe are accurate and reliable. The primers have low cost and relatively good practicality.

The invention discloses an SNP detecting kit for methionine-folic acid metabolism key enzymes MTHFR and a use method thereof. Corresponding specific primers and fluorescence probes for detecting MTHFR C677T polymorphism and MTHFR A1298C polymorphism are added, a real-time fluorescence quantification PCR system is formed, and through a real-time PCR, technicists in the field determine and detect the genotype of a corresponding MTHFR gene locus through data collected by a fluorogenic quantitative PCR amplifier. The advantages of being fast and sensitive, facilitating judgment and the like are achieved, and the SNP detecting kit and the use method thereof are suitable for clinical detection and popularization.

The invention discloses a folic acid metabolism gene polymorphism detecting primer, comprising (1) detection primers for polymorphic sites of MTHFR gene (rs1801133, C677T): an upstream primer as shownin SEQ ID No. 1, a downstream primer as shown in SEQ ID No. 2 and a probe as shown in SEQ ID No. 3; (2) detection primers for polymorphic sites of MTHFR gene (rs1801131, a1298C): upstream primers asshown in SEQ ID No. 4, downstream primers as shown in SEQ ID No. 5 and probes as shown in SEQ ID No. 6; (3) detection primers for polymorphic sites of MTRR gene (rs1801394, a66G): upstream primers asshown in SEQ ID No. 7, downstream primers as shown in SEQ ID No. 8 and probes as shown in SEQ ID No. 9. The invention also discloses the use of the detecting primer in preparing a folic acid metabolism gene polymorphism detecting reagent and a folic acid metabolism gene polymorphism detecting reagent kit. The detecting primer provided by the invention can simultaneously complete the genotyping ofthree loci in a single-tube PCR system, and has the advantages of simple and convenient operation, strong specificity, high sensitivity, high accuracy and easy interpretation.

The invention provides a lactic acid bacterium composition which is prepared from streptococcus thermophilus inm25-ST, lactobacillus delbrueckii subsp. bulgaricus inm25-LB and a promoting factor. Thecomposition is used for improving folic acid metabolism capability of the lactobacillus sobrinus LZ217 during fermentation and has the advantages that the production performance is good and stable, and the lactic acid bacterium composition can be put into a factory for mass production. In addition, the obtained fermented product has good taste, texture and flavor, less whey separation in a qualityguarantee period, weak post-acidification and high active folic acid content.

The invention discloses a detection method for folic acid metabolism-related gene mutation loci. The detection method comprises the steps that a sample DNA is extracted; specific primers used for amplifying folic acid metabolism-related gene segments are designed; the single-tube multi-PCR amplification reaction is carried out so as to obtain target fragments; single-base extension primers used for the folic acid metabolism-related gene segments are designed; single base extension is carried out on the folic acid metabolism-related gene fragmentx; and nucleic acid mass spectrometry analysis iscarried out so as to measure the target DNA sequences. The detection method has the advantages that folic acid metabolism-related gene mutation screening can be effectively carried out on patients with colorectal cancer, the individual can be helped to fully understand the hereditary condition of the individual, and a clinical and scientific research foundation is laid for carrying out personalized accurate diagnosis and treatment on the patients. The invention further relates to a detection kit for the folic acid metabolism-related gene mutation loci.

The invention discloses a method for typing genes associated with folic acid metabolism and a kit. The method comprises the following steps: amplifying: amplifying a sample DNA by using a PCR primer to obtain a PCR product and purifying the PCR product, wherein the PCR primer comprises nucleotide sequences as shown as SEQ ID NO: 1 to SEQ ID NO: 6; extending: performing single base extension on thepurified PCR product by using an extension primer SEQ ID NO: 9 for a 1298th site of MTHFR, an extension primer SEQ ID NO: 10 for a 677th site of the MTHFR and an extension primer SEQ ID NO: 11 for a66th site of MTRR and purifying an extension product; performing flight mass spectrometry: transferring the purified extension product to a mass spectrometry chip for mass spectrometry. According to the technical scheme, multiple detection of a reaction is achieved, the reagent cost and other cost such as manpower cost, disposable consumable cost and laboratory operation cost are greatly reduced,and the throughput of a detected sample is greatly increased.

The invention provides a kit and method for genotyping detection of polymorphism sites of metabolism ability genes of folic acid. The kit includes a mutation-type reaction system and a wild-type reaction system, wherein the reaction systems include rs1801133 groups, rs1801131 groups and rs1801394 groups, and the structures of primers, probes and inhibitors in each group are disclosed. The problemsof high requirements for template quality and insufficient timeliness can be solved during detection of polymorphism typing of the metabolism genes MTHFR and MTRR of folic acid, only the two tubes ofreaction systems are needed, one-time sampling and one-time closed detection can be realized, and polymorphism of three sites of 677C>T, 1298A>C and 66A>G of the gene MTHFR are detected in real time;and the kit and method have stable systems and good sensitivity and specificity.

The invention provides a kit for guiding a folic acid taking dose for pregnant women. The kit consists of MTHFR C667T, MTHFR A1298C and MTRR A66G amplification primers and a PCR reaction reagent. The invention also provides a method of using the kit. According to the kit provided by the invention, folic acid metabolism-related genes of the pregnant women are detected by virtue of an HRM method, and then, folic acid supplementing and taking are guided for the pregnant women in accordance with genotype, so that the pregnant women can safely and effectively take folic acid and the occurrence of such circumstances as spontaneous abortion, premature delivery, neural tube defects and the like can be relieved.

The invention provides a specific primer-probe combination and an application thereof to detection of folic acid metabolic capability genes by combining direct blood amplification with a fluorescent PCR method. Aiming at the C677T locus of the MTHFR gene, the specific primer-probe combination comprises target gene ARMS primers, a universal primer and a fluorescent probe, and specifically comprisesa C genotype specific primer AGAAGGTGTCTGCGGGATC, a T genotype specific primer AGAAGGTGTGTCTGCGGATT, a universal primer GGGACGATGGGGCAAGTG, and a fluorescent probe 5'-HEX-TTCTTCCGCTTTGTGGAAGGCATGC-BHQ1-3'. For an anticoagulant whole blood sample, a nucleic acid releasing agent, an amplification enzyme and the specific primer-probe combination are added into a reaction system to carry out a fluorescent PCR program, so that a corresponding genotype can be obtained.

The invention relates to plant folic acid extraction, in particular to extraction and quantitative methods for folic acid in corn grains. The extraction method comprises the following steps of takingcorn grain freeze-dried powder, adding a new extracting solution, carrying out ultrasonic vortex, oscillating at the temperature of 100 DEG C for 10 minutes, and rapidly cooling on ice; adding alpha-amylase and carrying out constant-temperature oscillating enzymolysis at 37 DEG C; adding protease and carrying out constant-temperature oscillating enzymolysis at 37 DEG C; and centrifuging and takingsupernate to obtain the folic acid, wherein a formula of the extracting solution is that every 100 ml of the extracting solution contains 249-349 mg of NaH2PO4, 659-759 mg of Na2HPO4.2H2O, 1-1.2 g ofL-ascorbic acid and 0.4-1.0 ml of 2-mercaptoethanol, and the pH is 6.8-7.0. According to the methods, 12 kinds of folic acid with different mantissa and oxidation states in the corn grains can be accurately quantified at the same time to provide technical support for dynamic analysis of the folic acid metabolites.

The invention provides a primer group and a method for detecting folic acid metabolic capability based on a MassArray nucleic acid mass spectrum platform and application of the method. The primer group for detecting SNP sites related to the folic acid metabolic capability and a detection system of the primer group are designed based on the MassArray nucleic acid mass spectrum platform, so that point mutation related to the folic acid metabolic capability can be accurately typed, and the primer group has the advantages of high accuracy, high sensitivity, good repeatability, low cost, short detection period, intuitive result and the like.

The invention relates to an application of antifolic in constructing a mouse model with neural tube defects (NTDs). Specifically, an anti-folic acid metabolism drug is adopted for intervening a pregnant mouse to generate folic acid dysbolism and cause abnormal embryonic development of the mouse, thereby constructing a mouse model with NTDs. The method adopted by the invention has simplicity of operation, good repeatability, high teratogenesis rate and stable effect, and simulates an animal model close to human on the pathogenesis of NTDs by obstructing normal metabolism of folic acid, thereby facilitating further studies on congenital anomalies, especially NTDs.

Compositions and methods for the prevention and treatment of osteoporosis are provided herein. The compositions contain one or more isoflavones, such as genistein and derivatives thereof, in combination with one or more folates, such as a reduced folate and / or folic acid; and / or one or more polyunsaturated fatty acids (PUFAs), such as an omega-3 and / or omega-6 fatty acid. The isoflavones, folates and / or essential fatty acid may be administered together or in separate dosage units. The compositions may optionally contain other vitamins, minerals, and ingredients, such as, emollient laxatives. The compositions are useful in the treatment of all forms of osteoporosis, including primary osteoporosis and secondary osteoporosis, and / or inflammatory joint diseases, especially in patients having a folic acid metabolism deficiency. The compositions are particularly useful in the treatment of inflammatory joint diseases, with complications that include bone loss, fracture, and osteoporosis. In addition, the compositions are beneficial for the prevention of osteoporosis in subjects who do not yet have the disease, but who are at risk for getting osteoporosis, such as post-menopausal women, subjects with osteopenia (mid thinning of the bone mass), subjects with an inflammatory joint disease, or people who are over the age of 70.

The invention relates to a compound sulfamethoxazole injection of which the pH value is 6.5-7.5. Every 100ml of injection contains 20-40g of sulfamethoxazole, 4-8g of trimethoprim, antioxidant and chelator. In the invention, the sulfamethoxazole and trimethoprim are combined, wherein the sulfamethoxazole acts on dihydrofolate synthetase in bacteria, and the trimethoprim acts on dihydrofolate reductase; and thus, the sulfamethoxazole and trimethoprim have a dual interception action on the folic acid metabolism of the bacteria, and enhance the antimicrobial efficacy by tens of times. The prepared finished product has the advantages of stable properties and high absorption speed after being injected, and overcomes the defects of low content, high pH value, great irritation, high crystallization tendency after long-term storage, complex and dangerous production technique and the like in the existing injection.

The invention discloses novel compound anticoccidial soluble powder and a preparation method thereof. According to the compound preparation disclosed by the invention, the problem of water solubility of trimethoprim medicine is changed by adopting a special process, the soluble powder is prepared, and the bioavailability is improved through drinking water administration; based on the cooperation of the trimethoprim and sulfachloropyrazine sodium, folic acid metabolism of coccidiosis can be blocked at the same time from two different links to achieve a synergistic effect. The TMP belongs to a sulfonamide synergistic drug, wherein the mechanism research shows that the TMP can obviously improve the anticoccidial index by being combined with sulfachloropyrazine sodium, the sulfachloropyrazine sodium and trimethoprim soluble powder is stable in drug property and exact in clinical test curative effect, the anticoccidial index of a single drug is obviously improved through combined drug use, and the drug use period is shortened, Therefore, revolutionary significance is realized on the treatment of coccidiosis diseases.

The invention relates to a compound sulfamethoxazole injection of which the pH value is 6.5-7.5. Every 100ml of injection contains 20-40g of sulfamethoxazole, 4-8g of trimethoprim, antioxidant and chelator. In the invention, the sulfamethoxazole and trimethoprim are combined, wherein the sulfamethoxazole acts on dihydrofolate synthetase in bacteria, and the trimethoprim acts on dihydrofolate reductase; and thus, the sulfamethoxazole and trimethoprim have a dual interception action on the folic acid metabolism of the bacteria, and enhance the antimicrobial efficacy by tens of times. The prepared finished product has the advantages of stable properties and high absorption speed after being injected, and overcomes the defects of low content, high pH value, great irritation, high crystallization tendency after long-term storage, complex and dangerous production technique and the like in the existing injection.

The invention discloses a kit for detecting polymorphism of folic acid metabolism genes. The kit comprises a PCR premix solution for detecting three SNP sites of folic acid metabolism genes MTHFR and MTRR, ARMS-PCR amplification primers and a quality control product. Whether the folic acid metabolism genes have mutation or not is judged by detecting the three SNP sites of the MTHFR and the MTRR, the kit is used for evaluating the folic acid metabolism capacity of individuals and specifically prompting the folic acid taking amount of a detected person, genotypes of the three mutation sites can be determined during use, and the kit has the technical advantages of rapidness, accuracy, low cost and simplicity in operation.

The invention provides a test kit for detecting folic acid metabolic pathway related genes. The kit comprises primer compositions for detecting an MTR gene RS1805087 site, a CBS gene RS5742905 site, aMTRR gene RS1801394 site, a MTHFR gene rs1801131 site and a MTHFR gene RS1801133 site, which are related to a folic acid metabolic pathway, the sequences of the primer compositions comprise five pairs of PCR primers and five forward extension primer compositions adjacent to SNP sites, and the forward extension primer compositions are shown as SEQ ID No: 1-15. The test kit not only can realize one-time multi-gene-site detection, but also reduces the lowest detection limit to 1ng / Mul, is high in detection rate, realizes large-flux rapid genotyping of gene site, and ensures the accuracy of sample detection to be 100%.

The invention discloses a method and a kit for detecting the genetic information of genes related to folic acid metabolism, involving three sites of MTHFR gene rs1801133, rs1801131 and MTRR gene rs1801394. The present invention comprehensively uses techniques such as direct PCR, nested PCR, multiplex PCR, enzyme cutting site PCR and PCR‑RFLP, and directly uses cells to perform two rounds of PCR amplification without extracting DNA. The second round of PCR products can be quickly digested and typed with the cheap restriction endonuclease HinfI. According to actual needs, three sites can be detected in the same tube at one time, and two sites can be detected in the same tube at one time. , and any one of them can be detected separately. All PCR products have enzyme digestion internal control sequences as the quality control of enzyme digestion to ensure the accuracy of the result judgment. The whole process is easy to operate, low in cost, and highly guaranteed in accuracy.