Lactic acid bacterium composition and application thereof
A composition, lactic acid bacteria technology, applied in application, Lactobacillus, Streptococcus/Lactococcus and other directions, can solve the problems of low folic acid yield, poor water retention capacity, low viscosity, etc., and achieve strong folic acid metabolism, soft and silky texture. , the effect of increasing folic acid content
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0021] Embodiment 1 A lactic acid bacteria composition, consisting of Streptococcus thermophilus inm25-ST, Lactobacillus delbrueckii subsp. bulgaricus inm25-LB and a promoting factor, the composition is used to improve the folic acid metabolism capacity of Lactobacillus sake LZ217 during fermentation .
[0022] A lactic acid bacteria composition, Lactobacillus delbrueckii subsp. bulgaricus, the strain name is inm25-LB, the preservation number of the strain is CGMCC No.15445, the preservation date is: March 12, 2018, and the preservation unit is: China Microbial Bacteria The Ordinary Microbiology Center of the Preservation Management Committee, the deposit address is: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.
[0023] The sequence of Lactobacillus delbrueckii subsp. bulgaricus inm25-LB provided by the present invention is shown.
[0024] gagtttgatc ctggctcatg acgatcgctg gcggcgtgcc taatacatgc aagtcgagcgagctgaattc aaagattcct tcggggtgat ttgttggatg ctagcggcgg a...
Embodiment 2
[0036] Embodiment 2 The strain screening method of Streptococcus thermophilus and Lactobacillus delbrueckii subsp. bulgaricus
[0037] Screening of excellent mucilage-producing and aroma-producing Streptococcus thermophilus
[0038] Taking the texture and viscosity of single-strain fermented milk, whey precipitation after simulated transportation, and flavor production as indicators, 4 strains were selected from more than 200 strains of Streptococcus thermophilus as the alternative Streptococcus thermophilus strains.
[0039] Screening of Lactobacillus delbrueckii subsp. bulgaricus with excellent post-acidification performance
[0040] Taking the low temperature (4°C 7d) acidity change and the fermentation end point (80oT) time of single-strain fermented milk as indicators, 4 strains were selected from more than 100 strains of Lactobacillus delbrueckii subsp. bulgaricus as the alternative Lactobacillus delbrueckii bulgaricus. subspecies strains.
[0041] Screening of composi...
Embodiment 3
[0043] The preparation of embodiment 3 lactic acid bacteria composition
[0044] 1. Culture and count of fermented lactic acid bacteria
[0045] The Streptococcus thermophilus inm25-ST and Lactobacillus delbrueckii subsp. bulgaricus inm25-LB stored in glycerol tubes were activated and cultured for 2 to 3 times, respectively, and the Streptococcus thermophilus strain inm25-ST was added to M17 liquid medium at 42°C. After culturing for 16h, Lactobacillus delbrueckii subsp. bulgaricus inm25-LB was added to MRS liquid medium, cultured at 42°C for 20h, under aseptic conditions, centrifuged at 3000rpm for 6min to precipitate the cells, remove the supernatant, and collect the cells. The bacterial counts were calculated separately.
[0046] 2. Preparation of strain composition
[0047] According to the bacterial count, the Streptococcus thermophilus inm25-ST and the Lactobacillus delbrueckii subsp. bulgaricus inm25-LB were mixed according to the bacterial count content of 1000:1 to ...
PUM
Property | Measurement | Unit |
---|---|---|
viscosity | aaaaa | aaaaa |
viscosity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com