Gene noninvasive detection kit for preventing neural tube defects of newborns
A technology for detecting kits and neural tubes is applied in the field of non-invasive gene detection kits for preventing neural tube defects in newborns, and can solve problems such as increased risk
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0020] Example 1. Use of detection kits
[0021] 1. Extract DNA template
[0022] The epithelial cells of the oral mucosa of the subjects were scraped, and the genomic DNA was extracted by the phenol-chloroform method.
[0023] 2. PCR amplification reaction
[0024] Use the PCR reaction component in the detection kit, which contains the following primer pairs:
[0025] (1) MTHFR C677T forward primer: 5'CATCCCTCGCCTTGAACAG 3'
[0026] MTHFR C677T reverse primer: 5′CAGACACTGTTGCTGGGTTTT 3′
[0027] (2) MTHFR A1298C forward primer: 5'GCCTCCAGACCAAAGAGTTACAT 3'
[0028] MTHFRA1298C reverse primer: 5′ CCACTCCAGCATCACTCACTTT 3′
[0029] (3) MTRR A66G forward primer: 5'GATTCAAGCCCAAGTAGTTTCG 3'
[0030] MTRR A66G reverse primer: 5′GCTCTAACCTTATCGGATTCACTA 3′
[0031] The reaction system for PCR amplification is: 10×PCR reaction buffer 2.5μl; 25mM dNTP mixture 0.2μl, 5U / ul Taq enzyme 0.125μl, DNA template 1μl (about 12-15ng), 20uM forward primer and reverse primer Each 0.25μl,...
Embodiment 2
[0046] Example 2. Services for non-invasive detection of neural tube defect prevention genes for people
[0047] Sampling and Extracting DNA
[0048]The physicians in the laboratory department of the hospital will guide the subjects to use oral swabs to sample oral epithelial cells, and use the phenol-chloroform method to extract DNA from oral epithelial cells
[0049] Genotyping
[0050] Using the kit provided by the invention, the rs1801133 SNP site (MTHFR C677T) and the rs1801131 SNP site (MTHFR A1298C) and 5 on the 5,10-methylenetetrahydrofolate reductase gene of the subject's genomic DNA , SNP site rs1801394 (MTRR A66G) on the 10-methylenetetrahydrofolate reductase gene was sequenced separately to determine the genotypes of the six SNPs sites.
[0051] Risk assessment of female high-risk groups in children with neural tube defects
[0052] Through the analysis of the SNPs genotypes of the subjects, a female risk assessment and analysis report for giving birth to childr...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 