Supercharge Your Innovation With Domain-Expert AI Agents!

Specific primer-probe combination and application thereof to detection of folate metabolic capability genes by combining direct blood amplification with fluorescent PCR method

A primer-probe, specific technology, applied in the field of gene diagnosis, can solve the problems of long process time and pollution cost, and achieve the effect of saving cost, reducing panic, and less sample demand.

Inactive Publication Date: 2020-04-17
SHANXI LIFEGEN
View PDF5 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The purpose of this application is to address the polymorphism of the C677T site of the MTHFR gene, and to solve the problems that the existing detection methods require blood DNA extraction, the process is time-consuming, easy to cause pollution, and the cost is high.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Specific primer-probe combination and application thereof to detection of folate metabolic capability genes by combining direct blood amplification with fluorescent PCR method
  • Specific primer-probe combination and application thereof to detection of folate metabolic capability genes by combining direct blood amplification with fluorescent PCR method
  • Specific primer-probe combination and application thereof to detection of folate metabolic capability genes by combining direct blood amplification with fluorescent PCR method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0050] The following describes in detail the present invention and its implementation effect comparison with the prior art through an embodiment in conjunction with the accompanying drawings.

[0051] An embodiment of the invention:

[0052] 1. Preliminary preparation:

[0053] Primer design: According to the nucleic acid sequence information near the C677T site of the MTHFR gene, ARMS primers and detection probes were designed, and internal reference gene primers and probes were designed at the same time. The primers were commissioned to Shanghai Sangon Biosynthesis.

[0054] Site sequence information:

[0055] >gnl|dbSNP|rs1801133|allelePos=501|totalLen=1001|taxid=9606|snpclass=1|alleles='C / T'|mol=Genomic|build=151

[0056] CAGGCTGTGCTGTGTGCTGTTGGAAGGTGCAAGATCAGAGCCCCCAAAGCAGAGGACTCTCTCTGCCCAGTCCTGTGGTCTCTTCATCCTCGCCTTGAACAGGTGGAGGCCAGCCTCTCCTGACTGTCATCCCTATTGGCAGGTTACCCCCAAAGGCCACCCCGAAGCAGGGAGCTTTGAGGCTGACCTGAAGCACTTGAAGGAGAAGGTGTCTGCGGGAG

[0057] Y

[0058] CGATTTCATCA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a specific primer-probe combination and an application thereof to detection of folic acid metabolic capability genes by combining direct blood amplification with a fluorescent PCR method. Aiming at the C677T locus of the MTHFR gene, the specific primer-probe combination comprises target gene ARMS primers, a universal primer and a fluorescent probe, and specifically comprisesa C genotype specific primer AGAAGGTGTCTGCGGGATC, a T genotype specific primer AGAAGGTGTGTCTGCGGATT, a universal primer GGGACGATGGGGCAAGTG, and a fluorescent probe 5'-HEX-TTCTTCCGCTTTGTGGAAGGCATGC-BHQ1-3'. For an anticoagulant whole blood sample, a nucleic acid releasing agent, an amplification enzyme and the specific primer-probe combination are added into a reaction system to carry out a fluorescent PCR program, so that a corresponding genotype can be obtained.

Description

technical field [0001] The application belongs to the field of gene diagnosis, and relates to a detection method for genotyping of folic acid metabolism capacity (MTHFR gene C677T site polymorphism). Background technique [0002] Methylene tetrahydrofolate reductase (MTHFR) is a key enzyme in the metabolism of folic acid in the human body, and the C677T site mutation is the most common polymorphism of the MTHFR gene. This mutation will lead to differences in enzyme activity and affect the body's folic acid metabolism. Studies have shown that C677T polymorphism is significantly related to cardiovascular and cerebrovascular diseases caused by high homocysteine, habitual abortion in pregnant women, birth defects such as neural tube defects, and congenital heart disease. my country's "Guidelines for the Rational Use of Hypertension" (Second Edition) and "Guidelines for Supplementing Folic Acid During Periconception to Prevent Neural Tube Defects (2017)" both clearly point out th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6883C12Q1/6858C12N15/11
CPCC12Q1/6883C12Q1/6858C12Q2600/156C12Q2535/137C12Q2563/107C12Q2531/113C12Q2561/113
Inventor 肖磊李刚颜桦郝婷
Owner SHANXI LIFEGEN
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More