Kit and method for polymorphism detection of metabolism ability genes MTHFR and MTRR of folic acid
A technology of gene polymorphism and detection kits, which is applied in biochemical equipment and methods, microbe measurement/inspection, DNA/RNA fragments, etc. It can solve the problems of high template quality requirements and insufficient timeliness, and achieve system stability , good sensitivity and specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0070] 1. Primers, probes and inhibitors for detecting polymorphisms of MTHFR gene 677C>T, MTHFR gene 1298A>C and MTRR gene 66A>G
[0071] 1) Design specific arms-PCR primers and probes according to the MTHFR gene sequence (Gene ID: 4524) published in the NCBI database, taking the 677C>T site (rs1801133) of the MTHFR gene as a reference, and referring to Premier's primer primer 5.0. Using the mutant plasmid and wild-type plasmid constructed by genetic engineering as templates, a real-time fluorescent PCR detection system was established to achieve high sensitivity and high specificity detection of rs1801133.
[0072] The primers and probes for detecting the 677C>T mutation of the MTHFR gene are characterized in that the detection primers and probes are designed according to the rs1801133 site of the MTHFR gene, and the sequences are as follows:
[0073] Wild-type ARMS upstream primer, 677-WF: AAGCTGCGTGATGATGACATAGG
[0074] Mutant ARMS upstream primer, 677-MF: AAGCTGCGTGATGA...
Embodiment 2
[0148] The usage of the kit of the present invention will be described in detail below in conjunction with specific example 2. Example 2 is implemented under the technical premise of the present invention, and provides detailed implementation methods and specific operating procedures. In Example 2, 19 blood samples were collected and named as samples No. 1-19 respectively. The results detected by the method of the present invention were compared with the results of first-generation sequencing to confirm the accuracy of the present invention.
[0149] 1. Extraction of Genomic DNA from 19 Blood Samples
[0150] Sample DNA was extracted using a commercially mature small amount of nucleic acid extraction kit. In the present invention, HiPure Blood DNA Midi Kit II (D3113-03, Magen), a nucleic acid extraction kit from Meiji Biology, is used, and the specific usage method refers to the kit instruction manual. The samples to be tested were extracted with commercial kits and stored fo...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


